Cyrtostylis reniformis

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Cyrtostylis

At a glance

Occurrence records3 670

Data sources5

Biological traits34

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Cyrtostylis reniformis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 670 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources34 traits

Occurrence & distributionGBIF3 670 records

DNA & barcodingNCBIsequences

01Narrative

Cyrtostylis reniformis, commonly known as common gnat-orchid, is a species of orchid endemic to eastern Australia. It usually has a single kidney-shaped leaf and a flowering spike with up to eight reddish flowers with a shelf-like labellum. Cyrtostylis huegelii is a similar species occurring in Western Australia and which some authorities regard as a synonym of Cyrtostylis reniformis var. huegelii.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology11

Leaf length27.5 mm

Leaf length max40 mm

Leaf length min15 mm

Leaf size1 100 mm²

Leaf width22 mm

Leaf width max35 mm

Leaf width min14 mm

Plant height0.07 m

Plant height max0.27 m

Plant height min0.03 m

Seed mass0.001 mg

Life cycle & reproduction8

Dispersal typewind

Flowering timennnnnnyyyynn

Life formtuberous geophyte

Life spanperennial

Pollination syndromeinsect

Raunkiær life formcryptophyte

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Habitat GIFTCoastal

Leaf compoundnesssimple

Leaf shapecordate orbicular reniform

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyrtostylis reniformis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF348020.1 ↗692 bp

ACGT

ATCATTGTCGAGACCCAAAAAGATCGCGAAACTCAGATAACACGTGAATAATCGATAAAAGCGGCGGTGATTTCGTCGCGAACGCTCATC …

Cyrtostylis reniformis 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

08Occurrence & distribution

Record type3 670 records

Wild obs. + sensor2 911

Museum / vouchered742

Cultivated / captive17

Origin

Native960

Introduced1

Range

Area of Occupancy AOO7 568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 1 359≤1 km 797≤10 km 312>10 km 145

2 613 georeferenced · 298 without coordinates

Open the mapobservation + sensor2 911

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 67≤1 km 162≤10 km 333>10 km 93

655 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence742

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy19% within 1 km

≤100 m 2≤1 km 1≤10 km 11>10 km 2

16 georeferenced · 1 without coordinates

Open the mapnot free-living17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	173
Canberra, AU	169
Adelaide, AU	123
Mount Annan, AU	99
Hobart, AU	66
Smithfield, AU	29
Brisbane, AU	24
Armidale, AU	11
QVMAGlocation not on record	8
Parkville, AU	7
NSW Dept of Planning, Industry and Environmentlocation not on record	5
Auckland, NZ	2
John T. Waterhouse Herbariumlocation not on record	1
Philadelphia, US	1
Christchurch, NZ	1
Palmerston, AU	1
La Trobe Universitylocation not on record	1
Universität Tübingenlocation not on record	1
South Kensington, GB	1

19 institutions · 723 of 742 vouchered records shown · 19 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cyrtostylis reniformis

At a glance

Sources5 archives

Size & morphology11

Life cycle & reproduction8

Diet & foraging1

Habitat & environment11

Physiology & chemistry2

Other traits1

At a glance

Record type3 670 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions13 of 19 geolocated

Cultivated / Captivenot free-living

Record type3 670 records