Cyrtopodium andersonii

(Lamb. ex Andrews) R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Cyrtopodium

At a glance

Occurrence records215

Data sources10

Biological traits13

DNA specimens3

eDNA detections2

Sources10 archives

Databases and archives Cyrtopodium andersonii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility215 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF215 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 46

01Narrative

Cyrtopodium andersonii is a species of orchid. It is native to South America (Brazil, Venezuela, Colombia and the Guianas).Kew World Checklist of Selected Plant Families It is the type species of the genus Cyrtopodium.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formpseudobulbous epiphyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max100 m

Elevation mean100 m

Elevation min0 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTCerrado (lato sensu), Floresta Ombrófila (= Floresta Pluvial), Restinga, Savana Amazônica, Vegetação Sobre Afloramentos Rochosos

Woodinessnon-woody

03Chemical composition1 compounds

Compounds documented for Cyrtopodium andersonii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Monomeric stilbenes1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Batatasin Iii		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyrtopodium andersonii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences6

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF470490.1 ↗699 bp

ACGT

GTTTCTGTAGGTGACCTACGGAAGGATCATTATCGAGACCGAAATATGTGTCGAGCGATCCGGAGAACCCGTGAGACGAGCGACAGCCGC …

Cyrtopodium andersonii isolate MWC341 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cyrtopodium andersonii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 46 n = 23

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 461×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Aoyama, M. 1989. Karyomorphological studies in Cymbidium and its allied genera, Orchidaceae. Bull. Hiroshima Bot. Gard. 11: 1–121.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type215 records

Wild obs. + sensor120

Museum / vouchered95

Origin

Native5

Range

Area of Occupancy AOO432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 32≤1 km 28≤10 km 5>10 km 19

84 georeferenced · 36 without coordinates

Open the mapobservation + sensor120

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 11

12 georeferenced · 83 without coordinates

Open the institutions mapphysical evidence95

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	14
Université de Bordeauxlocation not on record	8
Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record	6
Saint Louis, US	5
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	5
Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record	4
University of Stellenboschlocation not on record	4
Paris, FR	3
Museu Paraense Emílio Goeldilocation not on record	3
Tampa, US	3
UFMGlocation not on record	3
Chicago, US	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Kew, GB	2
Universidad Nacional de Colombia (UNAL)location not on record	2
UNESP-RClocation not on record	2
Porto Velho, BR	2
Anton de Kom University of Surinamelocation not on record	1
Cambridge, US	1
Harvard Universitylocation not on record	1
JBRJlocation not on record	1
Universidad Industrial de Santander (UIS)location not on record	1
Universität Tübingenlocation not on record	1
South Kensington, GB	1
Fort Worth, US	1
St. Augustine, TT	1

26 institutions · 79 of 95 vouchered records shown · 16 without an institution code

09Environmental DNA2 detections

Where the DNA of Cyrtopodium andersonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)