Cyrtochiloides ochmatochila

(Rchb.f.) N.H.Williams & M.W.Chase · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Cyrtochiloides

At a glance

Occurrence records87

Data sources9

Biological traits10

DNA specimens5

eDNA detections5

Sources9 archives

Databases and archives Cyrtochiloides ochmatochila's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility87 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~2.15 Gbp↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF87 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceGoaT2.2 Gbp

01Narrative

Cyrtochiloides ochmatochila is a species of orchid. The genus Cyrtochiloides N.H.Williams & M.W.Chase (2001) comprises a small group of Neotropical epiphytes, previously included under a broad concept of Oncidium Sw., with a new, more accurate identity based on DNA. Cyrtochiloides is akin to the mainly South American Cyrtochilum Kunth (1815). After having found its species scattered in Oncidium and several other genera, recently Cyrtochilum received notable acceptance by botanists, primarily based on the molecular discoveries made by Williams and Chase, as well as morphological analyses carried out by Stig Dalström. DNA samples illustrate that Oncidium ochmatochilum Rchb.f. and several other species have only a diluted connection with the core species of Oncidium. This new genus forms part of a well-supported clade including Otoglossum (Schltr.) Garay & Dunsterville, Cyrtochilum, the Andean group of Caucaea Schltr. (also previously retained under Oncidium as the section Cucullata), and Miltoniopsis God.-Leb.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life formpseudobulbous epiphyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max2 000 m

Elevation min0 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Woodinessnon-woody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyrtochiloides ochmatochila has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences3

eDNA detections5

The DNA barcodea real sequence read deposited for this species

ITSAF432946.1 ↗756 bp

ACGT

TCGCCGCCCGTGACTCGGCGAGAAGTCCATTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCG …

Cyrtochiloides ochmatochila 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Cyrtochiloides ochmatochila carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 151 600 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Cyrtochiloides ochmatochila2.15 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type87 records

Wild obs. + sensor42

Museum / vouchered36

Other9

Range

Area of Occupancy AOO264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 13≤1 km 7≤10 km 3>10 km 9

32 georeferenced · 10 without coordinates

Open the mapobservation + sensor42

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	11
Instituto Chinoin, A.C.location not on record	6
Bronx, US	5
Museo Nacional de Costa Rica (MNCR)location not on record	3
Tapachula, MX	2
Austin, US	2
National Biodiversity Institute, Costa Ricalocation not on record	2
Harvard Universitylocation not on record	1
Saint Louis, US	1
Station d'Ecologie de Lamtolocation not on record	1
Universidad del Valle (UniValle)location not on record	1
South Kensington, GB	1

12 institutions · 36 of 36 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Cyrtochiloides ochmatochila was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)