Cyrtanthus falcatus

R.A.Dyer · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Amaryllidaceae/Cyrtanthus

At a glance

Occurrence records3

Data sources11

Biological traits15

DNA specimens2

eDNA detections2

Sources11 archives

Databases and archives Cyrtanthus falcatus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS · NPASS15 compounds

Occurrence & distributionGBIF3 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Cyrtanthus falcatus, the falcate fire lily, is a species of flowering plant in the amaryllis family Amaryllidaceae from the Natal region of South Africa. A bulbous perennial growing to 30 cm, it has glossy, strap-shaped leaves and erect burgundy-coloured stems. These bear umbels of 8-10 narrowly-flared, pendulous tubular flowers in shades of red, green and cream in spring and summer. The umbels are bent over in a curious crook or sickle shape (hence The Latin specific epithet falcatus, “shaped like a sickle”). The plant goes dormant in winter. The bulb, shaped like a bowling pin, rests with its neck above the soil line.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.3 m

Plant height min0.25 m

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 800 m

Elevation min1 100 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition15 compounds

Compounds documented for Cyrtanthus falcatus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Amarylidaceae alkaloids5

Amarylidaceae alkaloids $ Isoquinoline alkaloids5

Stigmastane steroids2

Fatty alcohols2

Ursane and Taraxastane triterpenoids1

Documented compounds15 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Galantamine	present	LOTUS
(1R,10S,12S)-4,5,12-trimethoxy-9-azatetracyclo[7.5.2.01,10.02,7]hexadeca-2,4,6,13-tetraene	present	LOTUS
(1S,13R,16S,18S)-18-methoxy-15-methyl-5,7,12-trioxa-15-azapentacyclo[11.7.0.01,16.02,10.04,8]icosa-2,4(8),9,19-tetraen-13-ol	present	LOTUS
(1S,13S,16R,18S)-18-methoxy-15-methyl-5,7,12-trioxa-15-azapentacyclo[11.7.0.01,16.02,10.04,8]icosa-2,4(8),9,19-tetraen-13-ol	present	LOTUS
(2R,3R,4S,5S,6R)-2-[[(3S,8R,9R,10R,13R,14R,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(3S,4aS,6aS,6bS,8aR,11S,12R,12aS,14aR,14bR)-4,4,6a,6b,8a,11,12,14b-octamethyl-2,3,4a,5,6,7,8,9,10,11,12,12a,14,14a-tetradecahydro-1H-picen-3-ol	present	NPASS
beta-Sitosterol	present	NPASS
Friedelin	present	NPASS
Hexacosan-1-ol	present	NPASS
Hydroquinone	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyrtanthus falcatus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU543607.1 ↗380 bp

ACGT

CGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTATCTGGCCAAGGGCACGCCTGCCTGGGCGTCACGCCTACCTGTGCTCC …

Cyrtanthus falcatus voucher UFS:Spies 7637 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cyrtanthus falcatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–182n range16median16mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 165×CCDB · book-fedorov · CCDB · Oberlander2016 · CCDB · Cave1956supp

CCDB · book-fedorov — Flory 1955b

CCDB · book-fedorov — Ising 1962

CCDB · book-fedorov — Wilsenach 1963

CCDB · Oberlander2016 — Strydom & Spies, 2005

CCDB · Cave1956supp — Flory 1955b

2n 181×CCDB · Cave1962

CCDB · Cave1962 — Ising 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 records

Wild obs. + sensor3

Range

Area of Occupancy AOO12 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced

Open the mapobservation + sensor3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA2 detections

Where the DNA of Cyrtanthus falcatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)