Cyrtanthus elatus

(Jacq.) Traub · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Amaryllidaceae/Cyrtanthus

At a glance

Occurrence records196

Data sources12

Biological traits15

DNA specimens5

eDNA detections5

Sources12 archives

Databases and archives Cyrtanthus elatus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility196 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS · NPASS115 compounds

Occurrence & distributionGBIF196 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB14.4 Gbp

01Narrative

Cyrtanthus elatus, the Scarborough lily, is a bulbous flowering plant which originates from the Cape Province of South Africa. Other common names are fire lily and George lily. Cultivars of the Scarborough lily have flowers which may be bright red, orange, yellow, or occasionally pink or white. The stems can grow to a height of 2 ft. They are relatively easy to grow in a warm, sheltered, frost-free spot. Alternatively, they can be grown under glass in pots. They require either full sun or slight shade. They flower in late summer or early autumn. The Latin specific epithet elatus means “tall”. This plant has gained the Royal Horticultural Society’s Award of Garden Merit (confirmed 2017).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.44 m

Plant height min0.2 m

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 200 m

Elevation min600 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition115 compounds

Compounds documented for Cyrtanthus elatus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Proanthocyanins15

Flavonols13

Fatty aldehydes13

Fatty alcohols10

Amarylidaceae alkaloids $ Isoquinoline alkaloids7

Documented compounds115 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-1(10),4-Cadinadiene	present	NPASS
(+)-2-Pentanol	present	NPASS
(+)-3-Carene	present	NPASS
(+)-alpha-Pinene	present	NPASS
(+)-Perillyl alcohol	present	NPASS
(+)-Ursolic Acid	present	NPASS
(-)-beta-Pinene	present	NPASS
(-)-Borneol	present	NPASS
(-)-Camphene	present	NPASS
(-)-Galantamine	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyrtanthus elatus has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences9

eDNA detections5

The DNA barcodea real sequence read deposited for this species

ITSEU543604.1 ↗292 bp

ACGT

CCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTATCTGGCCAAGGGCACGCCTGCCTGGGCGTCACGCCTACCTGCGCTC …

Cyrtanthus elatus voucher UFS:Spies 7636 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL1★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cyrtanthus elatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size14 425 500 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Cyrtanthus elatus14.43 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–182n range16median16mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 168×CCDB · ipcn-api-dl · CCDB · book-indian_vol2 · CCDB · book-fedorov +2

CCDB · ipcn-api-dl — Zemskova, E. A. & L. I. Sveshnikova. 1999. Karyological study of some representatives of the family Amaryllidaceae. Bot. Žhurn. (Moscow & Leningrad) 84(4): 86–98.

CCDB · book-indian_vol2 — Sato, D 1942; Gouws, J.B. 1949; Ising, G. 1962

CCDB · book-indian_vol2 — Thornton (Tischler, G. 1931) ; Sato, D. 1942 ; Tjio, J. & Levan, A. 1950

CCDB · book-fedorov — Thornton (T. 1931)

CCDB · book-fedorov — SatO D. 1942

CCDB · book-fedorov — Tjio, Levan 1950

CCDB · book-atlas-flowering-plants — Sato 1942

CCDB · Oberlander2016 — Strydom & Spies, 2005

2n 181×CCDB · Cave1962

CCDB · Cave1962 — Ising 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type196 records

Wild obs. + sensor155

Museum / vouchered39

Cultivated / captive2

Origin

Introduced2

Range

Area of Occupancy AOO368 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 114≤1 km 17≤10 km 6>10 km 1

138 georeferenced · 17 without coordinates

Open the mapobservation + sensor155

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 39 records without

Open the institutions mapphysical evidence39

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	16
Pretoria, ZA	12
Auckland, NZ	6
Cape Town, ZA	3
Parkville, AU	2

5 institutions · 39 of 39 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Cyrtanthus elatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)