Cyrtandra waianaeensis — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Gesneriaceae/Cyrtandra

At a glance

Occurrence records1

Data sources5

Biological traits22

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Cyrtandra waianaeensis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF1 records

DNA & barcodingNCBIsequences

01Narrative

Cyrtandra waianaeensis, the Waianae cyrtandra, is a species of flowering plant in the family Gesneriaceae, native to Oahu, Hawaii. A shrubby tree reaching , it is recommended as an accent or specimen plant due to its textured greenish-yellow to green foliage.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology11

Fruit length max20 mm

Fruit length min15 mm

Leaf length max270 mm

Leaf length min90 mm

Leaf width max80 mm

Leaf width min30 mm

Plant height6.1 m

Plant height max7 m

Plant height min1 m

Seed length max0.6 mm

Seed length min0.5 mm

Life cycle & reproduction3

Dehiscenceindehiscent

Life formshrub or tree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit typeberry

Growth formshrub

Woodinesswoody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyrtandra waianaeensis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF446149.1 ↗636 bpUSA

ACGT

GATCATTGTCGAACCTGCAAAGGAGACCCGTGAACATGATTAAATACGCTTGCGGCTGCGATGTCGGATGCTTTAGCGTCCCACATCACG …

Cyrtandra waianaeensis isolate MJ189 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type1 records

Wild obs. + sensor1

Range

Area of Occupancy AOO4 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapobservation + sensor1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.