Cypripedium macranthos

Sw. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Cypripedium

At a glance

Occurrence records3 068

Data sources13

Biological traits14

DNA specimens13

eDNA detections13

Sources13 archives

Databases and archives Cypripedium macranthos's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 068 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF3 068 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD · NCBI13 specimens

Genome at a glanceCCDB · GoaT36.6 Gbp

01Narrative

Cypripedium macranthos, the large-flowered cypripedium, is a species of orchid. It is native to Belarus, Russia (European Russia and Siberia), Mongolia, Japan, Korea, Taiwan and China (Hebei, Heilongjiang, Jilin, Liaoning, Nei Mongol, Shandong).Flora of China v 25 p 26, 大花杓兰 da hua shao lan, Cypripedium macranthosKew World Checklist of Selected Plant Families

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.45 m

Plant height min0.25 m

Life cycle & reproduction5

Flowering endJul

Flowering startJun

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, forest edges

Woodinessnon-woody

03Chemical composition2 compounds

Compounds documented for Cypripedium macranthos across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Phenanthrenes1

Flavones1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Chrysin		present	LOTUS
Lusianthrin		present	LOTUS

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cypripedium macranthos has left across the world's sequence archives.

At a glance

DNA specimens13

Marker genes3

GenBank sequences10

eDNA detections13

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOR660158.1 ↗416 bp

ACGT

TAATTTGTCATTGGGCCTCCTCCAAAGCTTTCCTTGTGGGTTTGAACCTCTAGCACGGCGCAGTATGCGCCAAGTCATATGAAGCATCAC …

Cypripedium macranthos voucher ALT23-061 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL6★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Cypripedium macranthos carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size36 577 200 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Cypripedium macranthos36.58 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–262n range20median20mode16records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2013×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.

CCDB · ipcn-api-dl — Kartashova, N. N., L. A. MALAKHOVA, Koslova & N. A. Dubrova. 1974. Chisla chromosom u rjada polesnykh rastenij is prirodnykh populjacij flory Priob'ja. Biol. Biofis. Tomsk. 47–53.

CCDB · ipcn-api-dl — Malakhova, L. A. 1990. Kariologocheskij analiz prirodnykh populjacij redkich i ischezajushchikh rastenij na juge Tomskoj Oblasti. Bjulleten' Glavnogo Botanic|5eskogo Sada 155: 60–66.

CCDB · ipcn-api-dl — Stepanov, N. V. 1994. Chromosome numbers of some higher plants taxa of the flora of Krasnoyarsk region. Bot. Žhurn. (Moscow & Leningrad) 79(2): 135–139.

CCDB · ipcn-api-dl — Malakhova, L. A. & G. A. Markova. 1994. Chromosome numbers in the flowering plants of Tomsk region. Monocotyledones. Bot. Žhurn. (Moscow & Leningrad) 79(7): 134–135.

CCDB · book-ipcn66 — Sokolovskaya 1966

CCDB · book-ipcn75-78 — Krogulevich 1978

CCDB · book-ipcn75-78 — Belaeva & SiplivinsKy 1976

CCDB · book-ipcn75-78 — Kartashova et al. 1974

CCDB · book-ipcn75-78 — Krogulevich 1976

CCDB · book-ipcn75-78 — Krasnoborov & Rostovtseva 1975

CCDB · kew — Hanson L, Leitch IJ, Bennett MD. 1999. Unpublished values from the Jodrell Laboratory, Royal Botanic Gardens, Kew.

2n 222×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Volkova, S. A. & P. G. Gorovoy. 2001. A study of chromosome numbers of the flora of the Bering islands (Commandore Islands). Pages 28--29 in Bioaktivnye veschestva iz morskikh macro- i microorganizmov i nazemnykh rastenii. Vladivostok.

CCDB · ipcn-api-dl — Volkova, S. A., P. G. Gorovoy & K. G. Tkachenko. 2003. Chromosome numbers of representatives of some families of the flora of Komandorskie islands. Bot. Žhurn. (Moscow & Leningrad) 88(8): 115–116.

2n 261×CCDB · Cave1956supp

CCDB · Cave1956supp — Mulay & Pan. 1953

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 068 records

Wild obs. + sensor2 612

Museum / vouchered455

Cultivated / captive1

Origin

Introduced1

Range

Area of Occupancy AOO6 788 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy42% within 1 km

≤100 m 607≤1 km 256≤10 km 131>10 km 1 085

2 079 georeferenced · 533 without coordinates

Open the mapobservation + sensor2 612

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 1≤1 km 43≤10 km 105>10 km 9

158 georeferenced · 297 without coordinates

Open the institutions mapphysical evidence455

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	151
Tsukuba, JP	62
Irkutsk State Universitylocation not on record	47
Beijing, CN	43
Kyoto Universitylocation not on record	17
KR	12
IWEP FEB RASlocation not on record	10
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	9
South Kensington, GB	9
BRNUlocation not on record	8
Guilin, CN	7
Herbarium of the Department of Botany, University of Tokyolocation not on record	7
Hokkaido University Museumlocation not on record	6
Taipei, TW	4
Institute of the biological problems of the North FEB RASlocation not on record	4
Kunming, CN	2
Odawara, JP	2
Ann Arbor, US	2
Taipei, TW	2
Sendai, JP	2
Servico de Microbiologia e Imunologialocation not on record	2
Dresden, DE	1
Bronx, US	1
Saint Louis, US	1
Elocation not on record	1
Wlocation not on record	1
Omachi Alpine Museumlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Edinburgh, GB	1
Philadelphia, US	1
Plocation not on record	1

31 institutions · 418 of 455 vouchered records shown · 29 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA13 detections

Where the DNA of Cypripedium macranthos was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.70 °C 7.40–10.0

Seasonal swing summer↔winter28.4 °C

Max temp (day)12.6 °C 9.60–15.7

Min temp (night)3.10 °C 3.00–3.10

Precipitation179 mm/mo 13.8–344

Air humidity55.3 % 45.7–64.9

Moisture balance83.7 mm/mo -95.2–263

Vapour deficit628 Pa 428–827

Wind speed3.70 m/s 2.90–4.50

Cloud cover34.4 % 24.1–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cypripedium macranthos

At a glance

Sources13 archives

Size & morphology2

Life cycle & reproduction5

Diet & foraging1

Habitat & environment6

Compound class profile2 classes

Documented compounds2 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type3 068 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions16 of 31 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 068 records