Cypripedium guttatum

Sw. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Cypripedium

At a glance

Occurrence records3 568

Data sources13

Biological traits22

DNA specimens10

eDNA detections8

Sources13 archives

Databases and archives Cypripedium guttatum's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 568 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

giftgenome & karyotype

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Occurrence & distributionGBIF3 568 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD · NCBI10 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Cypripedium guttatum, the spotted lady's slipperGo Orchids, North American Orchid Conservation Center or Alaskan lady's slipper, is a species of orchid found on three continents. It is native to Belarus, Russia (European Russia, Siberia and Russian Far East) as well as China (Hebei, Heilongjiang, Jilin, Liaoning, Nei Mongol, Ningxia, Shaanxi, Shandong, Shanxi, Sichuan, Tibet, and Yunnan), Korea, Mongolia, Bhutan, Alaska (including the Aleutians) and northern Canada (Yukon and Northwest Territories). It grows in forests, thickets, and grassland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height generative0.205 m

Plant height max0.3 m

Plant height min0.15 m

Life cycle & reproduction5

Flowering endJun

Flowering startMay

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max4 100 m

Elevation min1 000 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest

Mycorrhiza typeE.t.end.

Woodinessnon-woody

Physiology & chemistry3

Leaf c456 mg/g

Leaf dry-matter content (LDMC)164 mg/g

Leaf n30.2 mg/g

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cypripedium guttatum has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes4

GenBank sequences10

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG216479.1 ↗392 bpCanada · 2010

ACGT

TGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCTAAGGGCACGCCTGCCTGGGCGTCGTGTATC …

Cypripedium guttatum voucher CCDB-18357-C12 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL6★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cypripedium guttatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidy2× diploid · measured

Chromosome records20–202n range20median20mode15records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2015×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +1

CCDB · iapt

CCDB · ipcn-api-dl — Krogulevich, R. E. 1984. In R.E. Krogulevich & T.S. Rostovtseva, Khromosomnye Chisla Tsvetkovykh Rastenii i Sibiri Dal'nego Vostoka. Izdatel'stvo "Nauka", Sibirskoe Otdelenie, Novosibirsk. ý.

CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.

CCDB · ipcn-api-dl — Kartashova, N. N., L. A. MALAKHOVA, Koslova & N. A. Dubrova. 1974. Chisla chromosom u rjada polesnykh rastenij is prirodnykh populjacij flory Priob'ja. Biol. Biofis. Tomsk. 47–53.

CCDB · ipcn-api-dl — Malakhova, L. A. 1990. Kariologocheskij analiz prirodnykh populjacij redkich i ischezajushchikh rastenij na juge Tomskoj Oblasti. Bjulleten' Glavnogo Botanic|5eskogo Sada 155: 60–66.

CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1991. Chromosome numbers in some species of vascular plants from the Pechoro-Ilychsky Reservation (Komi ASSR). Bot. Žhurn. (Moscow & Leningrad) 76: 473–476.

CCDB · ipcn-api-dl — Stepanov, N. V. 1994. Chromosome numbers of some higher plants taxa of the flora of Krasnoyarsk region. Bot. Žhurn. (Moscow & Leningrad) 79(2): 135–139.

CCDB · ipcn-api-dl — Malakhova, L. A. & G. A. Markova. 1994. Chromosome numbers in the flowering plants of Tomsk region. Monocotyledones. Bot. Žhurn. (Moscow & Leningrad) 79(7): 134–135.

CCDB · book-ipcn66 — Sokolovskaya 1966

CCDB · book-ipcn75-78 — Belaeva & Siplivinsky 1975

CCDB · book-ipcn75-78 — Kartashova et al. 1974

CCDB · book-ipcn75-78 — Krogulevich 1978

CCDB · book-ipcn75-78 — Krogulevich 1976

CCDB · book-ipcn75-78 — Krasnoborov & Rostovtseva 1975

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GIFT · GIFT (floras)

GIFT · GIFT (floras)

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

polyploid1×GIFT · GIFT (floras)

GIFT · GIFT (floras)

08Occurrence & distribution

Record type3 568 records

Wild obs. + sensor2 776

Museum / vouchered788

Other4

Range

Area of Occupancy AOO8 896 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy47% within 1 km

≤100 m 673≤1 km 305≤10 km 333>10 km 779

2 090 georeferenced · 686 without coordinates

Open the mapobservation + sensor2 776

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤1 km 115≤10 km 94>10 km 30

239 georeferenced · 549 without coordinates

Open the institutions mapphysical evidence788

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions25 of 45 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	257
Beijing, CN	99
Irkutsk State Universitylocation not on record	61
IB-Komi-SC-UB-RASlocation not on record	58
Institute of the biological problems of the North FEB RASlocation not on record	34
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	21
South Kensington, GB	18
Servico de Microbiologia e Imunologialocation not on record	11
Bronx, US	11
Kunming, CN	10
Chicago, US	10
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	8
Chengdu, CN	8
Tsukuba, JP	8
IWEP FEB RASlocation not on record	7
Guilin, CN	6
Anchorage, US	6
BRNUlocation not on record	6
Harvard Universitylocation not on record	6
Madison, US	6
Whitehorse, CA	6
Vancouver, CA	5
Saint Louis, US	5
Philadelphia, US	4
GMBAlocation not on record	4
WTUlocation not on record	3
Cambridge, US	3
Chongqing Museumlocation not on record	3
University of Alberta Museumslocation not on record	3
Research Collection of B. A. Bennettlocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Uppsala, SE	2
Herbarium of the Department of Botany, University of Tokyolocation not on record	2
Guangzhou, CN	1
Kyoto Universitylocation not on record	1
Wuzhou, CN	1
LDlocation not on record	1
Davis, US	1
Christchurch, NZ	1
Fort Worth, US	1
MeiseBGlocation not on record	1
Bloomington, US	1
Cambridge, US	1
Tampa, US	1
Dresden, DE	1

45 institutions · 707 of 788 vouchered records shown · 75 without an institution code

09Environmental DNA8 detections

Where the DNA of Cypripedium guttatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 12.6–13.8

Seasonal swing summer↔winter32.7 °C

Max temp (day)18.1 °C 17.9–18.4

Min temp (night)8.40 °C 8.30–8.50

Precipitation72.3 mm/mo 66.5–78.2

Air humidity55.5 % 54.1–57.0

Moisture balance-48.0 mm/mo -55.7–-40.3

Vapour deficit737 Pa 734–741

Wind speed3.90 m/s 2.40–5.40

Cloud cover38.7 % 37.1–40.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cypripedium guttatum

At a glance

Sources13 archives

Size & morphology3

Life cycle & reproduction5

Diet & foraging1

Habitat & environment10

Physiology & chemistry3

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 568 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions25 of 45 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 568 records