Cypripedium candidum

Muhl. ex Willd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Cypripedium

At a glance

Occurrence records1 152

Data sources11

Biological traits11

DNA specimens7

eDNA detections5

Sources11 archives

Databases and archives Cypripedium candidum's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 152 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF1 152 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Cypripedium candidum, known as the small white lady's slipper or white lady's slipper, is a rare orchid of the genus Cypripedium. It is native to eastern North America across the northern United States and southern Canada.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formrhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Mycorrhiza type0.996667951

Woodinessnon-woody

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cypripedium candidum has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes5

GenBank sequences9

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSEF370092.1 ↗644 bpUSA

ACGT

GGTGGACTTGTGGTTACTCAGCTCGCCATAGGCTTTGCTTTTGCGGTGACCCTAATTTGTCATTGGGCCTCCTCCAAAGCTTTCCTTGTG …

Cypripedium candidum isolate P133 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL5★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cypripedium candidum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 203×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · eflora

CCDB · ipcn-api-dl — Love, A. & D. Love. 1981c. In Chromosome number reports LXXIII. Taxon 30: 845–851.

CCDB · book-ipcn67-71 — LOEVE, A., & w. SIMON. 1968. Cytotaxonomical notes on some American orchids. southw. Naturalist 13: 335-342.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 152 records

Wild obs. + sensor959

Museum / vouchered193

Range

Area of Occupancy AOO3 652 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy13% within 1 km

≤100 m 105≤1 km 17≤10 km 7>10 km 808

937 georeferenced · 22 without coordinates

Open the mapobservation + sensor959

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 6≤1 km 18≤10 km 70>10 km 18

112 georeferenced · 81 without coordinates

Open the institutions mapphysical evidence193

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	51
International Salmonella Centre (W.H.O.)location not on record	26
Bronx, US	19
Philadelphia, US	16
Madison, US	10
Tampa, US	9
WINlocation not on record	8
Wuzhou, CN	7
Saint Louis, US	6
Chicago, US	4
Davenport, US	4
Chongqing Museumlocation not on record	4
University of Guelph, OAC Herbariumlocation not on record	2
Bloomington, US	2
Dekalb, US	2
Millersville, US	2
Columbia, US	2
Santa Barbara, US	2
Ann Arbor, US	2
Museum of the Rockieslocation not on record	2
Missoula, US	1
Fullerton, US	1
Walla Walla, US	1
US	1
BAYLUlocation not on record	1
Denver, US	1
Burlington, US	1
New Haven, US	1
Austin, US	1

29 institutions · 189 of 193 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Cypripedium candidum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 13.0–19.2

Seasonal swing summer↔winter27.0 °C

Max temp (day)19.0 °C 18.5–22.6

Min temp (night)12.2 °C 9.00–16.4

Precipitation91.5 mm/mo 82.0–95.0

Air humidity57.5 % 57.4–58.2

Moisture balance-53.3 mm/mo -78.1–-41.3

Vapour deficit735 Pa 733–932

Wind speed5.80 m/s 5.40–6.00

Cloud cover39.9 % 37.3–43.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cypripedium candidum

At a glance

Sources11 archives

Life cycle & reproduction3

Diet & foraging1

Habitat & environment7

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 152 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions23 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 152 records