Cypripedium calceolus
speciesAt a glance
Occurrence records75 875
Data sources14
Biological traits31
DNA specimens43
eDNA detections79
Sources14 archives
Databases and archives Cypripedium calceolus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility75 875 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI79 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics43 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources31 traits
Chemical compositionLOTUS · NPASS86 compounds
Occurrence & distributionGBIF75 875 records
Environmental DNA2 datasets · 5 countries79 detections
DNA & barcodingBOLD · NCBI43 specimens
Genome at a glanceCCDB · GoaT33.5 Gbp
01Narrative
Le sabot de Vénus, ou sabot de Vénus d'Europe (Cypripedium calceolus), est une espèce de plantes à fleurs de la famille des Orchidacées, de la sous-famille des Cypripedioideae et du genre Cypripedium, qui se rencontre sur des sols alcalins. Il est parfois appelé sabot de la Vierge ou soulier de Notre-Dame.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology6
Plant height0.325 m
Plant height generative0.35 m
Plant height max0.6 m
Plant height min0.25 m
Seed length0.9 mm
Seed mass0.003 mg
Life cycle & reproduction11
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typehuman
⚠ sources differ — LEDA: ethelochor · GIFT: anemochorous
Flowering endJun
Flowering startJun
Life formrhizomatous geophyte
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formcryptophyte
Seed number2 512
Self fertilizationabsent
Diet & foraging1
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
Habitat GIFTthin deciduous and mixed woods, coppices, glades
Mycorrhiza typeorchid
Woodinessnon-woody
Physiology & chemistry3
Leaf dry-matter content (LDMC)176 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)30.92 mm²/mg
Other traits2
Diaspore typeseed
Plant support typefree-standing
03Chemical composition86 compounds
Compounds documented for Cypripedium calceolus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Neolignans8
Isocoumarins7
Cinnamic acids and derivatives7
Simple phenolic acids6
Disaccharides $ Polysaccharides4
Documented compounds86 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Pinoresinol | present | NPASS | |
| (-)-pinoresinol-4,4'-di-O-beta-D-glucopyranoside | present | NPASS | |
| (2R,3R)-2-(4-hydroxy-3-methoxyphenyl)-3-(hydroxymethyl)-5-(3-hydroxypropyl)-2,3-dihydro-1-benzofuran-7-ol | present | NPASS | |
| (2R,3R,4S,4aS,8aS)-4-(hydroxymethyl)-3,4a,8,8-tetramethyl-2,4,5,6,7,8a-hexahydro-1H-naphthalene-2,3-diol | present | NPASS | |
| (2R,3R,4S,5S,6R)-2-[(2R,3S)-4-hydroxy-2,3-bis[(4-hydroxy-3-methoxyphenyl)methyl]butoxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | NPASS | |
| (2R,3S)-2,3-Dihydro-2-(4-hydroxy-3-methoxyphenyl)-5-((1E)-3-hydroxy-1-propen-1-yl)-7-methoxy-3-benzofuranmethanol | present | NPASS | |
| (2R,3S,4S,5R,6S)-2-(hydroxymethyl)-6-[4-(3-hydroxypropyl)phenoxy]oxane-3,4,5-triol | present | NPASS | |
| (2R,3S,4S,5R,6S)-2-(hydroxymethyl)-6-[4-[(2R,3S)-3-(hydroxymethyl)-5-(3-hydroxypropyl)-7-methoxy-2,3-dihydro-1-benzofuran-2-yl]-2-methoxyphenoxy]oxane-3,4,5-triol | present | NPASS | |
| (2S)-1-[(2S,6R)-6-methylpiperidin-2-yl]propan-2-ol | present | NPASS | |
| (2S,3R)-2,3-bis[(4-hydroxy-3-methoxyphenyl)methyl]butane-1,4-diol | present | NPASS |
05DNA & barcoding43 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cypripedium calceolus has left across the world's sequence archives.
At a glance
DNA specimens43
Marker genes5
GenBank sequences10
eDNA detections79
Countries6
The DNA barcodea real sequence read deposited for this species
CATTGTTGAGACAGCAGAATATATGATCGAGTGAATCCGGTGGACTTGTGGTTACTCAGCTCGACATAGGCTTTGCTTTTGCGGTGACCC …
Cypripedium calceolus strain SL internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL2★rbcLa★ITS8★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Cypripedium calceolus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size33 465 812 755 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
WHEAT17 Gb
THIS GENOME Cypripedium calceolus33.47 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 20 n = 10
Ploidy2× diploid · measured
Chromosome records20–222n range20median20mode33records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2030×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +8
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — DEL PRETE C. - 1979 (1978). Contributi alla conoscenza delle Orchidaceae d'Italia. VI. Tavole cromosomiche delle "Orchidaceae" italiane con alcune considerazioni citosistematiche sui generi "Ophrys", "Orchis" e "Serapias".. Inform. Bot. Ital. , 10(3): 379-389.
CCDB · ita-fl — DEL PRETE C., GARBARI F., GIORDANI A. - 1980. Numeri cromosomici per la flora italiana:690-695.. Inform. Bot. Ital. , 12(2): 117-120.
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · iapt
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4902
CCDB · fl-europaea — Skalinska et al.,
CCDB · poland — Skali?ska M., Banach-Pogan E., Wcis?o H. et al. 1957. Further studies in chromosome numbers of Polish Angiosperms. Acta Soc. Bot. Pol. 26, 215-246.
CCDB · ipcn-api-dl — Averyanov, L. V., E. L. Averyanova & A. N. Lavrenko. 1982a. Karyosystematic study of orchids (Orchidaceae) on the territory of the Komi ASSR. Bot. Zhurn. 67 (11): 1491–1499. (In Russian).
CCDB · ipcn-api-dl — Semerenko, L. V. 1989. Chromosome numbers in some members of the families Asteraceae, Fabaceae, Orchidaceae and Poaceae from the Berezinsky Biosphere Reservation (Byelorussia) flora. Bot. Žhurn. (Moscow & Leningrad) 74: 1671–1673.
CCDB · ipcn-api-dl — Malakhova, L. A. 1990. Kariologocheskij analiz prirodnykh populjacij redkich i ischezajushchikh rastenij na juge Tomskoj Oblasti. Bjulleten' Glavnogo Botanic|5eskogo Sada 155: 60–66.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1991. Chromosome numbers in some species of vascular plants from the Pechoro-Ilychsky Reservation (Komi ASSR). Bot. Žhurn. (Moscow & Leningrad) 76: 473–476.
CCDB · ipcn-api-dl — Malakhova, L. A. & G. A. Markova. 1994. Chromosome numbers in the flowering plants of Tomsk region. Monocotyledones. Bot. Žhurn. (Moscow & Leningrad) 79(7): 134–135.
CCDB · ipcn-api-dl — DEL PRETE, C. 1978. Contributi alla conoscenza della Orchidaceae d'ltalia. Vl. Tavole cromosomiche delle Orchidaceae italiane con alcune considerazioni citosistematiche sui generi Ophrys, Orchis, e Serapias. Inform. Bot. Ital. 10: 379–389.
CCDB · ipcn-api-dl — DEL PRETE, C., F. Garbari & A. Giordani. 1980. Numeri cromosomicl per la Flora Italiana: 690-695. Inform. Bot. Ital. 12: 117–120.
CCDB · ipcn-api-dl — Engelskjon, T. 1979. Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1–38.
CCDB · ipcn-api-dl — Averyanov, L. V. 1979. Chromosome numbers of some species of Orchidaceae from the northwestern part of the USSR. Bot. Zhurn. 64 (6): 863–877.
CCDB · book-ipcn66 — Sokolovskaya 1966
CCDB · eflora
CCDB · CromoCat 2015 — Averyanov, L. V. (1979). Chromosome numbers of some species of Orchidaceae family from the North-Western part of U.S.S.R. Bot. Žurn. 64: 863-877.
CCDB · CromoCat 2015 — Averyanov, L. V., Averyanova, E. L. & Lavrenko, A. N. (1982b). Karyosystematic study of orchids (Orchidaceae) on the territory of the Komi ASSR. Bot. Žurn. 67: 1491-1499.
CCDB · CromoCat 2015 — Del Prete, C. (1978). Contributi alla conoscenza delle "Orchidaceae" d'Italia. VI. Tavole cromosomiche delle "Orchidaceae" italiane con alcune considerazioni citosistematiche sui generi "Ophrys", "Orchis" e "Serapias". Inf. Bot. Ital. 10: 379-389.
CCDB · CromoCat 2015 — Del Prete, C. , Garbari, F. & Giordani, A. (1980). Numeri cromosomicl per la Flora Italiana: 690-695. Informatore Botanico Italiano 12: 117-120.
CCDB · CromoCat 2015 — Engelskjon, T. (1979). Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1-38.
CCDB · CromoCat 2015 — Lavrenko, A. N., Serditov, N. P. & Ulle, L. G. (1991). Chromosome numbers in some species of vascular plants from the Pechoro-Ilychsky Reservation (Komi ASSR) Bot. Žurn. 76: 473-476.
CCDB · CromoCat 2015 — Malakhova, L. A. & Markova, G. A. (1994). Chromosome numbers in the flowering plants of Tomsk region. Monocotyledones Bot. Žurn. 79(7): 134-135
CCDB · CromoCat 2015 — Malakhova, L. A. (1990). Kariologocheskij analiz prirodnykh populjacij redkich i ischezajushchikh restenij na juge Tomskoj Oblasti. Bull. Glavn. Bot. Sada 155: 60-66.
CCDB · CromoCat 2015 — Semerenko, L. V. (1989). Chisla khromosom nekotorykh pretstavitelei semeistv Asteraceae, Fabaceae, Orchidaceae, Poaceae flory Berezinskogo Biosfernogo Zapovednika (BSSR). Bot. Žurn. 74(11): 1671-1673.
2n 223×CCDB · ita-fl · CCDB · poland · CCDB · book-atlas-flowering-plants
CCDB · ita-fl — FRANCINI E. - 1931. Ricerche embriologiche e cariologiche sul genere "Cypripedium" s.l.. N. Giorn. Bot. Ital., n.s. , 38(1): 155-212.
CCDB · poland — ?ukowski and Anders (unpubl.)
CCDB · book-atlas-flowering-plants — Francini 1931
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type75 875 records
Wild obs. + sensor69 973
Museum / vouchered5 415
Cultivated / captive1
Other486
Origin
Native63
Introduced46
Range
Area of Occupancy AOO57 048 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy35% within 1 km
≤100 m 17 248≤1 km 5 156≤10 km 37 025>10 km 4 993
64 422 georeferenced · 5 551 without coordinates
Open the mapobservation + sensor69 973
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy20% within 1 km
≤100 m 120≤1 km 585≤10 km 2 204>10 km 605
3 514 georeferenced · 1 901 without coordinates
Open the institutions mapphysical evidence5 415
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions67 of 143 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BFLlocation not on record | 512 |
| Zürich, CH | 492 |
| Uniwersytet Wrocławskilocation not on record | 357 |
| Zürich, CH | 326 |
| Moscow State Universitylocation not on record | 314 |
| Helsinki, FI | 256 |
| Olocation not on record | 206 |
| Uppsala, SE | 194 |
| LDlocation not on record | 161 |
| Bern, CH | 134 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 123 |
| IB-Komi-SC-UB-RASlocation not on record | 122 |
| Tartu, EE | 109 |
| Philadelphia, US | 103 |
| Salzburg, AT | 90 |
| Trondheim, NO | 88 |
| TROMlocation not on record | 88 |
| BRNUlocation not on record | 60 |
| CJBGlocation not on record | 57 |
| GJOlocation not on record | 56 |
| SLU Artdatabankenlocation not on record | 53 |
| KFGBlocation not on record | 53 |
| Oulu, FI | 52 |
| Oskarshamn, SE | 51 |
| Wlocation not on record | 51 |
| South Kensington, GB | 49 |
| Adam Mickiewicz University in Poznańlocation not on record | 47 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 43 |
| Kuopio, FI | 40 |
| Lausanne, CH | 40 |
| Bergen, NO | 35 |
| Philadelphia, US | 35 |
| Irkutsk State Universitylocation not on record | 33 |
| Tallinn, EE | 33 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 32 |
| Tampa, US | 29 |
| Dresden, DE | 28 |
| Québec, CA | 28 |
| Toronto, CA | 23 |
| GZUlocation not on record | 20 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 19 |
| Madison, US | 17 |
| Turku, FI | 17 |
| Mlocation not on record | 16 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 16 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 16 |
| University of Winnipeglocation not on record | 13 |
| KMNlocation not on record | 12 |
| Frauenfeld, CH | 11 |
| Glarus, CH | 11 |
| Servico de Microbiologia e Imunologialocation not on record | 9 |
| Beijing, CN | 9 |
| Bozeman, US | 9 |
| UNINE:NEUlocation not on record | 9 |
| Provincia di Livornolocation not on record | 9 |
| UGentlocation not on record | 9 |
| Kandalaksha State Nature Reservelocation not on record | 8 |
| MeiseBGlocation not on record | 8 |
| Christchurch, NZ | 8 |
| H-Wolflocation not on record | 8 |
| Porrentruy, CH | 8 |
| Institute of the biological problems of the North FEB RASlocation not on record | 8 |
| Acadia Universitylocation not on record | 7 |
| NMBU:MINAlocation not on record | 7 |
| BIO-UNIPIlocation not on record | 7 |
| New Haven, US | 6 |
| Montréal, CA | 6 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 6 |
| Kostrzyca Forest Gene Banklocation not on record | 6 |
| Missoula, US | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 5 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 5 |
| TUR-Alocation not on record | 5 |
| Frankfurt am Main | 5 |
| Winterthur, CH | 5 |
| Xiamen, CN | 5 |
| University of Birminghamlocation not on record | 5 |
| IWEP FEB RASlocation not on record | 5 |
| Staten Island, US | 4 |
| Tromso University Museumlocation not on record | 4 |
| Kyoto Universitylocation not on record | 4 |
| BDBClocation not on record | 3 |
| Rovaniemi, FI | 3 |
| US | 3 |
| Saint Louis, US | 3 |
| BClocation not on record | 3 |
| Berlin, DE | 3 |
| Görlitz, DE | 3 |
| University of Gdansk, Dept. of Plant Taxonomy & Nature Conservationlocation not on record | 3 |
| Davenport, US | 3 |
| University of Alberta Museumslocation not on record | 2 |
| Paris, FR | 2 |
| Victoria, CA | 2 |
| Jyväskylä, FI | 2 |
| Lubbock, US | 2 |
| ENHMlocation not on record | 2 |
| Moscow, US | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 2 |
| Cambridge, US | 2 |
| Vancouver, CA | 2 |
| Smithsonian Institutionlocation not on record | 2 |
| Porvoo, FI | 2 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 2 |
| Cheney, US | 1 |
| Chicago, US | 1 |
| BMlocation not on record | 1 |
| Salamanca, ES | 1 |
| WTUlocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| Vitebsk State University named after P.M. Masherovlocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| PRClocation not on record | 1 |
| NBSIlocation not on record | 1 |
| Badajoz, ES | 1 |
| KR | 1 |
| MAlocation not on record | 1 |
| Université Lavallocation not on record | 1 |
| Pechora-Ilych Nature Reservelocation not on record | 1 |
| Fullerton, US | 1 |
| NTNU University Museum, Department of Natural Historylocation not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| Dhaka, BD | 1 |
| BSBIlocation not on record | 1 |
| SZUlocation not on record | 1 |
| Waverly, US | 1 |
| IPE-CSIClocation not on record | 1 |
| Corvallis, US | 1 |
| Provo, US | 1 |
| Tsukuba, JP | 1 |
| Austin, US | 1 |
| Anton de Kom University of Surinamelocation not on record | 1 |
| ASUlocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| University of Lethbridgelocation not on record | 1 |
| Jefferson City, US | 1 |
| Sion, CH | 1 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 1 |
| Pomona Collegelocation not on record | 1 |
| Barcelona, ES | 1 |
| IFR-DNFlocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Phoenix, US | 1 |
| Fort Worth, US | 1 |
143 institutions · 5 069 of 5 415 vouchered records shown · 343 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA79 detections
Where the DNA of Cypripedium calceolus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found79
Studies independent surveys2
Countries5
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 79 detections have coordinates
Open the map5 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.9 °C 12.7–17.2
Seasonal swing summer↔winter21.3 °C
Max temp (day)21.2 °C 15.7–21.4
Min temp (night)12.0 °C 8.20–12.4
Precipitation67.3 mm/mo 66.5–88.8
Air humidity59.7 % 59.1–62.5
Moisture balance-52.4 mm/mo -56.4–-8.00
Vapour deficit787 Pa 563–788
Wind speed3.30 m/s 3.00–3.80
Cloud cover32.9 % 32.2–41.8
CHELSA 1981–2010, ~9 km grid, at location & month of 65 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.