Cyprinodon bovinus

Baird & Girard, 1853 · species

image placeholder — illustration coming later

Animalia/Chordata/Cyprinodontiformes/Cyprinodontidae/Cyprinodon

At a glance

Occurrence records313

Data sources8

Biological traits5

DNA specimens63

eDNA detections3

Sources8 archives

Databases and archives Cyprinodon bovinus's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility313 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics63 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF313 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD63 specimens

01Narrative

The Leon Springs pupfish (Cyprinodon bovinus) is a species of fish in the family Cyprinodontidae. It is endemic to Pecos County, Texas in the United States. It is a federally listed endangered species. The Leon Springs pupfish is found at the shallow edges of spring-fed wetland pools, where it is most frequently observed in areas without vegetation.. Its diet consists of diatoms, amphipods, and ostracods. This fish was first discovered in 1851 at Leon Springs, near Fort Stockton, Texas. Leon Springs was impounded, poisoned, stocked with game fish,Kennedy, S. E. (1977). Life history of the Leon Springs Pupfish, Cyprinodon bovinus. Copeia 1977(1) 93. and drained, and the fish was considered extinct by 1938. In the 1960s it was rediscovered at Diamond Y Spring a few miles away.USFWS. Listing of Leon Springs Pupfish as endangered with critical habitat. Federal Register August 15, 1980. It is also found in the Diamond Y Draw, a tributary of the Pecos River.Garrett, G., et al. (2002). Threatened fishes of the world: Cyprinodon bovinus Baird & Girard, 1853 (Cyprinodontidae). Environmental Biology of Fishes 64(4) 442.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length5.6 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importancecommercial

Other traits1

Vulnerability10

05DNA & barcoding63 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyprinodon bovinus has left across the world's sequence archives.

At a glance

DNA specimens63

Marker genes1

eDNA detections3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P425 bp consensus63 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

TGGGCGACGACCAAATTTATAACGTAATCGTCACCGCTCATGCATTTGTAATAATCTTTTTTATGGTTATACCTATCATGATTGGGGGCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.03%

Haplotypes3

BINs0

Most divergent pair0.47%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Cyprinodon variegatussame genus3.8%Cyprinodon maculariussame genus4.7%Cyprinodon nazassame genus5.4%Cyprinodon artifronssame genus5.6%Cyprinodon verecundussame genus5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_056956 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12SrRNA16SrRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

07Deep time~1.13 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin1.13 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type313 records

Wild obs. + sensor11

Museum / vouchered302

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 11

11 georeferenced

Open the mapobservation + sensor11

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 136≤1 km 4≤10 km 18>10 km 71

229 georeferenced · 73 without coordinates

Open the institutions mapphysical evidence302

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Texas Biodiversity Collections (UTBC)location not on record	210
Texas Memorial Museum, Texas Natural History Collectionlocation not on record	18
ASUlocation not on record	10
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
Ann Arbor, US	2
Cambridge, US	1
North Carolina Museum of Natural Scienceslocation not on record	1
Champaign, US	1
South Kensington, GB	1

9 institutions · 246 of 302 vouchered records shown · 56 without an institution code

09Environmental DNA3 detections

Where the DNA of Cyprinodon bovinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)