Cyphophoenix nucele — The Life Data

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Cyphophoenix

At a glance

Occurrence records25

Data sources8

Biological traits21

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Cyphophoenix nucele's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility25 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Occurrence & distributionGBIF25 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Cyphophoenix nucele is a species of flowering plant in the family Arecaceae. It is found only in New Caledonia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Fruit length21 mm

Fruit width12 mm

Leaf length max2 000 mm

Plant height15 m

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourred

Growth formtree

Habitat GIFTcanopy

Woodinesswoody

Other traits6

Dbh max20 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max1 500 cm

Shoot orientationerect

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyphophoenix nucele has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences8

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK692245.1 ↗474 bp

ACGT

AATTGCAGAATCCCGCGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGAGGCCACTCGGCCGAGGGCACGCCTGCCTGGGCGTCACGC …

Cyphophoenix nucele voucher XMBG177 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK2rbcL5ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type25 records

Wild obs. + sensor1

Museum / vouchered24

Range

Area of Occupancy AOO20 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence24

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	19
Bronx, US	3
Kew, GB	1
Miami, US	1

4 institutions · 24 of 24 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Cyphophoenix nucele was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.