Cyphophoenix elegans — The Life Data

Plantae/Tracheophyta/Liliopsida/Arecales/Arecaceae/Cyphophoenix

At a glance

Occurrence records56

Data sources5

Biological traits25

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Cyphophoenix elegans's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility56 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF56 records

DNA & barcodingNCBIsequences

01Narrative

Cyphophoenix elegans est une espèce de plantes de la famille des Arecaceae. L'espèce est trouvée en Nouvelle-Calédonie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Fruit length19.5 mm

Fruit length max20 mm

Fruit length min19 mm

Fruit width13.5 mm

Fruit width max14 mm

Fruit width min13 mm

Leaf length max2 500 mm

Plant height15 m

Life cycle & reproduction3

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit colourgreen

Growth formtree

Habitat GIFTcanopy

Woodinesswoody

Other traits6

Dbh max14 cm

Defenseno

Leaf spinesno

Plant support typefree-standing

Shoot length max1 500 cm

Shoot orientationerect

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyphophoenix elegans has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMK692244.1 ↗474 bp

ACGT

AATTGCAGAATCCCGCGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGAGGCCACTCGGCCGAGGGCACGCCTGCCTGGGCGTCACGC …

Cyphophoenix elegans voucher XMBG141 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type56 records

Wild obs. + sensor14

Museum / vouchered42

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 14

14 georeferenced

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 42 records without

Open the institutions mapphysical evidence42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	42

1 institutions · 42 of 42 vouchered records shown