Cyperus virens
Michx. · speciesAt a glance
Occurrence records1 611
Data sources6
Biological traits24
DNA specimens3
eDNA detections1
Sources6 archives
Databases and archives Cyperus virens's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility1 611 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics3 specimens↗
NCBIUS National Library of Medicinesequences↗
Open Tree of LifeOpenTreephylogeny backbone↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources24 traits
Occurrence & distributionGBIF1 611 records
Environmental DNA1 datasets · 1 countries1 detections
DNA & barcodingBOLD · NCBI3 specimens
01Narrative
Cyperus virens adalah spesies tumbuhan yang tergolong ke dalam famili Cyperaceae. Spesies ini juga merupakan bagian dari ordo Poales. Spesies Cyperus virens sendiri merupakan bagian dari genus Cyperus. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh Michx..
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology9
Fruit length max1.5 mm
Fruit length min1.2 mm
Leaf width max9 mm
Leaf width min7 mm
Plant height max0.9 m
Plant height min0.3 m
Seed mass0.1 mg
Seed mass max0.1 mg
Seed mass min0.1 mg
Life cycle & reproduction4
Dehiscenceindehiscent
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifeform raunkiaer detailedgeophyte
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 820 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Campo de Altitude, Campo Limpo, Campo Rupestre, Cerrado (lato sensu), Floresta Ombrófila (= Floresta Pluvial), Floresta Ombrófila Mista
Woodinessnon-woody
05DNA & barcoding3 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyperus virens has left across the world's sequence archives.
At a glance
DNA specimens3
Marker genes4
GenBank sequences10
eDNA detections1
Countries1
The DNA barcodea real sequence read deposited for this species
TCATTTAGAGGAAGGAGAATCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCNTTGTCGTTGCCTTCAAACATGACCGGTGAAC …
Cyperus virens voucher Pereira-Silva, L. 390 (FLOR) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL2★rbcLa★ITS5
plant barcodefungal barcode
08Occurrence & distribution
Record type1 611 records
Wild obs. + sensor485
Museum / vouchered1 092
Other34
Origin
Native120
Range
Area of Occupancy AOO4 204 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy88% within 1 km
≤100 m 274≤1 km 45≤10 km 18>10 km 25
362 georeferenced · 123 without coordinates
Open the mapobservation + sensor485
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy67% within 1 km
≤100 m 131≤1 km 35≤10 km 59>10 km 23
248 georeferenced · 844 without coordinates
Open the institutions mapphysical evidence1 092
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions80 of 149 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 71 |
| Porto Alegre, BR | 58 |
| Jackson, US | 58 |
| Jena Microbial Resource Collectionlocation not on record | 57 |
| Bronx, US | 56 |
| Austin, US | 51 |
| Valdosta State Universitylocation not on record | 44 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 40 |
| Tampa, US | 39 |
| Columbia, US | 37 |
| Blumenau, BR | 36 |
| Paleontological Collectionlocation not on record | 32 |
| Fort Worth, US | 30 |
| Durango, MX | 28 |
| US | 27 |
| Mexico City, MX | 25 |
| UFMSlocation not on record | 18 |
| Ann Arbor, US | 17 |
| Guasave, MX | 13 |
| BAYLUlocation not on record | 13 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 11 |
| Chongqing Museumlocation not on record | 10 |
| GAlocation not on record | 9 |
| University of Southern Mississippilocation not on record | 9 |
| UFSClocation not on record | 9 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 9 |
| Universidade Federal de Santa Catarinalocation not on record | 9 |
| Kew, GB | 8 |
| Université de Bordeauxlocation not on record | 8 |
| Tall Timbers Research Stationlocation not on record | 8 |
| Universidade Federale do Rio Grande do Sullocation not on record | 8 |
| Istituto Agrario Castelnuovolocation not on record | 7 |
| Juriquilla, MX | 7 |
| AUAlocation not on record | 7 |
| UNESClocation not on record | 6 |
| Miami, US | 6 |
| Campo Mourão, BR | 5 |
| UTFPR-CPlocation not on record | 5 |
| Bangkok, TH | 5 |
| DanBIFlocation not on record | 4 |
| Ivano-Frankivsk, UA | 4 |
| Laboratorio de Ictiologialocation not on record | 4 |
| San Angelo, US | 4 |
| Mississippi State, US | 4 |
| Riverside, US | 4 |
| CASlocation not on record | 4 |
| UNICAMPlocation not on record | 4 |
| Salvador, BR | 4 |
| Clemson, US | 4 |
| University of Stellenboschlocation not on record | 4 |
| Feira de Santana, BR | 4 |
| Criciúma, BR | 4 |
| Logan, US | 3 |
| Chapel Hill, US | 3 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 3 |
| Tuscaloosa, US | 3 |
| UnBlocation not on record | 3 |
| Londrina, BR | 3 |
| Denver, US | 3 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 3 |
| Chicago, US | 3 |
| San Isidro, AR | 3 |
| South Kensington, GB | 3 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 3 |
| Maringá, BR | 2 |
| Lincoln, US | 2 |
| Knoxville, US | 2 |
| Masindi, UG | 2 |
| San Francisco, US | 2 |
| Texas Lutheran Universitylocation not on record | 2 |
| UFBAlocation not on record | 2 |
| Moscow State Universitylocation not on record | 2 |
| Wuzhou, CN | 2 |
| Flagstaff, US | 2 |
| Santa Cruz de la Sierra, BO | 2 |
| Corrientes, AR | 2 |
| Cascavel, BR | 2 |
| Auckland, NZ | 2 |
| Burlington, US | 2 |
| ASUlocation not on record | 2 |
| Universidade Federal de Sergipe (UFS)location not on record | 2 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 2 |
| Badajoz, ES | 2 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| UEMlocation not on record | 1 |
| Oskarshamn, SE | 1 |
| Durham, US | 1 |
| Zacatecas, MX | 1 |
| Sangmiung Universitylocation not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Wellington, NZ | 1 |
| Campo Grande, BR | 1 |
| CJBGlocation not on record | 1 |
| Cornell Universitylocation not on record | 1 |
| EL PASO, US | 1 |
| Altos de Pipe, VE | 1 |
| Mexico City, MX | 1 |
| Austin, US | 1 |
| Victoria, CA | 1 |
| Denton, US | 1 |
| Davis, US | 1 |
| Philadelphia, US | 1 |
| Museu Paraense Emílio Goeldilocation not on record | 1 |
| UEGlocation not on record | 1 |
| Eastern Illinois Universitylocation not on record | 1 |
| Mount Annan, AU | 1 |
| UFSJlocation not on record | 1 |
| Chapingo, MX | 1 |
| New Haven, US | 1 |
| IPA/SPlocation not on record | 1 |
| Lubbock, US | 1 |
| BMlocation not on record | 1 |
| Ciudad de México, MX | 1 |
| Minia, EG | 1 |
| Santa Maria, BR | 1 |
| UTFPR-DVlocation not on record | 1 |
| Cenit Transporte y Logística de Hidrocarburos S.A.S. (CENIT)location not on record | 1 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 1 |
| Brasília, BR | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Honolulu, US | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| JBRJlocation not on record | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Foz do Iguaçu, BR | 1 |
| Granada, ES | 1 |
| Universidad Nacional Agrarialocation not on record | 1 |
| Universidad Nacional de Asunciónlocation not on record | 1 |
| Lake Charles, US | 1 |
| Ciudad de México, MX | 1 |
| Columbus State University Herbariumlocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| National Biodiversity Institute, Costa Ricalocation not on record | 1 |
| Williamsburg, US | 1 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 1 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 1 |
| FUVATESlocation not on record | 1 |
| Cambridge, US | 1 |
| Antiguo Cuscatlán, SV | 1 |
| Chaguaramas, TT | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| University of Zhejianglocation not on record | 1 |
| Córdoba, AR | 1 |
| PUC-RSlocation not on record | 1 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 1 |
| UNESP-RClocation not on record | 1 |
| UNIVILLElocation not on record | 1 |
| Green Bay, US | 1 |
149 institutions · 1 088 of 1 092 vouchered records shown · 4 without an institution code
09Environmental DNA1 detections
Where the DNA of Cyperus virens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found1
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 1 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.4 °C 15.4–15.4
Seasonal swing summer↔winter17.4 °C
Max temp (day)20.2 °C
Min temp (night)12.4 °C
Precipitation56.1 mm/mo
Air humidity57.6 %
Moisture balance-27.8 mm/mo
Vapour deficit737 Pa
Wind speed4.10 m/s
Cloud cover42.1 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.