Cyperus surinamensis
Rottb. · speciesAt a glance
Occurrence records4 075
Data sources9
Biological traits17
DNA specimens4
eDNA detections2
Sources9 archives
Databases and archives Cyperus surinamensis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 066 records↗
OBISOcean Biodiversity Information System9 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics4 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources17 traits
Occurrence & distributionGBIF · OBIS4 075 records
Environmental DNA1 datasets · 1 countries2 detections
DNA & barcodingBOLD · NCBI4 specimens
01Narrative
刺稈莎草（学名：）又名苏里南莎草，为莎草科莎草屬下的一个种。种名 surinamensis 意为“苏里南的”。
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPTRYAusTraitsGIFT
Size & morphology3
Seed mass0.022 mg
⚠ sources differ — TRY: 0.022 mg · GIFT: 0.02 mg
Seed mass max0.02 mg
Seed mass min0.02 mg
Life cycle & reproduction3
Life formannual or perennial
Life spanannual short_lived_perennial
⚠ sources differ — AusTraits: annual short_lived_perennial · GIFT: perennial
Raunkiær life formtherophyte
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 000 m
Elevation mean245 m
Elevation min0 m
Epiphyteterrestrial
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid · TRY: Herb
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Cerrado (lato sensu), Floresta Ciliar ou Galeria, Vegetação Aquática
Woodinessnon-woody
05DNA & barcoding4 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyperus surinamensis has left across the world's sequence archives.
At a glance
DNA specimens4
Marker genes4
GenBank sequences10
eDNA detections2
Countries3
The DNA barcodea real sequence read deposited for this species
CGGAGGATCATTGTCGTCGCCTTCAAACATGACCGGTGAACACGTAACACAAAGCTATCGGGGAGGGTCATCCCCCCCGACCCCACGGCC …
Cyperus surinamensis voucher sZGh00108956 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL4★rbcLa★ITS3
plant barcodefungal barcode
08Occurrence & distribution
Record type4 075 records
Wild obs. + sensor1 074
Museum / vouchered2 886
Other115
Origin
Native679
Range
Area of Occupancy AOO9 916 km²
Depth
0–200 m sunlit8
200–1000 m twilight0
1–4 km midnight0
>4 km abyssal0
median 1 m · max 1 m · 8 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy91% within 1 km
≤100 m 656≤1 km 79≤10 km 25>10 km 52
812 georeferenced · 262 without coordinates
Open the mapobservation + sensor1 074
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy72% within 1 km
≤100 m 249≤1 km 14≤10 km 66>10 km 37
366 georeferenced · 2 520 without coordinates
Open the institutions mapphysical evidence2 886
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions99 of 199 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 244 |
| Bronx, US | 208 |
| Durango, MX | 146 |
| Tampa, US | 138 |
| Université de Bordeauxlocation not on record | 113 |
| Mexico City, MX | 94 |
| Masindi, UG | 79 |
| UNIVASFlocation not on record | 63 |
| Altos de Pipe, VE | 61 |
| Ciudad de México, MX | 59 |
| Jena Microbial Resource Collectionlocation not on record | 59 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 54 |
| Porto Alegre, BR | 50 |
| Universidade Federal de Sergipe (UFS)location not on record | 49 |
| Miami, US | 48 |
| University of Stellenboschlocation not on record | 47 |
| UFPElocation not on record | 45 |
| Laboratorio de Ictiologialocation not on record | 41 |
| Kew, GB | 41 |
| Ann Arbor, US | 41 |
| National Biodiversity Institute, Costa Ricalocation not on record | 36 |
| UFMSlocation not on record | 35 |
| Salvador, BR | 35 |
| Austin, US | 31 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 30 |
| UnBlocation not on record | 29 |
| St. Augustine, TT | 28 |
| Feira de Santana, BR | 27 |
| Chaguaramas, TT | 27 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 26 |
| Universidade Federal do Vale do São Franciscolocation not on record | 24 |
| JBRJlocation not on record | 22 |
| UFERSAlocation not on record | 20 |
| UFBAlocation not on record | 20 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 18 |
| Xiamen, CN | 18 |
| Blumenau, BR | 18 |
| Departamento de Sistematica e Ecologialocation not on record | 17 |
| Cenargenlocation not on record | 17 |
| Cuiabá, BR | 17 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 17 |
| Brasília, BR | 16 |
| UFESlocation not on record | 15 |
| Riverside, US | 15 |
| Federal University of Espírito Santolocation not on record | 15 |
| Universidade Federal de Santa Catarinalocation not on record | 14 |
| UFSClocation not on record | 14 |
| CPATSAlocation not on record | 14 |
| Universidad Nacional de Colombia (UNAL)location not on record | 14 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 14 |
| Wuzhou, CN | 13 |
| CEPLAClocation not on record | 13 |
| UFRPElocation not on record | 13 |
| Universidade Federale do Rio Grande do Sullocation not on record | 12 |
| UFMGlocation not on record | 12 |
| Museu Paraense Emílio Goeldilocation not on record | 11 |
| Fortaleza, BR | 11 |
| Paleontological Collectionlocation not on record | 11 |
| Aarhus, DK | 11 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 11 |
| Brasília, BR | 11 |
| MAlocation not on record | 10 |
| Antiguo Cuscatlán, SV | 10 |
| EL PASO, US | 10 |
| IECOSlocation not on record | 9 |
| Guasave, MX | 9 |
| Chicago, US | 9 |
| Universidade Federal do Maranhãolocation not on record | 8 |
| Istituto Agrario Castelnuovolocation not on record | 8 |
| Ilhéus, BR | 8 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 7 |
| Paris, FR | 7 |
| USP-IBlocation not on record | 7 |
| UEMlocation not on record | 7 |
| Mexico City, MX | 6 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 6 |
| Tuxtla Gutiérrez, MX | 6 |
| UEPAlocation not on record | 6 |
| UNICAMPlocation not on record | 6 |
| Chapingo, MX | 6 |
| León, NI | 6 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 6 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 5 |
| GB | 5 |
| IPA/SPlocation not on record | 5 |
| Armidale, AU | 5 |
| Wlocation not on record | 5 |
| Cambridge, US | 5 |
| Maringá, BR | 5 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 5 |
| San José, CR | 5 |
| San Isidro, AR | 4 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 4 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 4 |
| Tall Timbers Research Stationlocation not on record | 4 |
| Culiacán, MX | 4 |
| South Kensington, GB | 4 |
| Teresina, BR | 4 |
| Loja, EC | 3 |
| UEMAlocation not on record | 3 |
| Sangmiung Universitylocation not on record | 3 |
| Criciúma, BR | 3 |
| Fort Worth, US | 3 |
| Mount Annan, AU | 3 |
| Zürich, CH | 3 |
| Santa Cruz de la Sierra, BO | 3 |
| Berlin, DE | 3 |
| VENlocation not on record | 3 |
| Uberlândia, BR | 3 |
| Mérida, MX | 3 |
| Taipei, TW | 3 |
| La Paz, MX | 3 |
| UNESClocation not on record | 3 |
| Ivano-Frankivsk, UA | 3 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 3 |
| UEGlocation not on record | 2 |
| Universidade Federal de Goiáslocation not on record | 2 |
| Kensington, AU | 2 |
| Palmerston, AU | 2 |
| QCNElocation not on record | 2 |
| Hanshan Normal Universitylocation not on record | 2 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 2 |
| Cruz das Almas, BR | 2 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 2 |
| Universidad Nacional Agrarialocation not on record | 2 |
| Brisbane, AU | 2 |
| BMlocation not on record | 2 |
| Badajoz, ES | 2 |
| Taipei, TW | 2 |
| Beijing, CN | 2 |
| Castelar, AR | 2 |
| Corrientes, AR | 2 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 2 |
| CJBGlocation not on record | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| Tapachula, MX | 2 |
| ASUlocation not on record | 2 |
| Santarém, BR | 2 |
| FUVATESlocation not on record | 2 |
| Durham, US | 2 |
| Austin, US | 2 |
| CNF-UFHBlocation not on record | 2 |
| MeiseBGlocation not on record | 2 |
| San Diego, US | 2 |
| Stockholm, SE | 2 |
| Millersville, US | 1 |
| Bogotá, D.C., CO | 1 |
| Oskarshamn, SE | 1 |
| UFOPlocation not on record | 1 |
| INMAlocation not on record | 1 |
| New Haven, US | 1 |
| CEPEC, CEPLAC e Universidade Federal do Sul da Bahialocation not on record | 1 |
| Autlán de Navarro, MX | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| Foz do Iguaçu, BR | 1 |
| Flagstaff, US | 1 |
| Colgate Universitylocation not on record | 1 |
| Frankfurt am Main | 1 |
| NO DISPONIBLElocation not on record | 1 |
| Mexico City, MX | 1 |
| University of Zhejianglocation not on record | 1 |
| Columbus State University Herbariumlocation not on record | 1 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 1 |
| Sucre, BO | 1 |
| Río Palenque Science Centerlocation not on record | 1 |
| LBVlocation not on record | 1 |
| Davis, US | 1 |
| COLlocation not on record | 1 |
| Córdoba, AR | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| Faculty of Applied Science, University of Sri Jayawardenepuralocation not on record | 1 |
| Managua, NI | 1 |
| Quito, EC | 1 |
| arosemena tola, EC | 1 |
| La Paz, BO | 1 |
| Escuela Agrícola Panamericanalocation not on record | 1 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 1 |
| Puerto Ayora, EC | 1 |
| Auckland, NZ | 1 |
| Anchorage, US | 1 |
| Toronto, CA | 1 |
| TAIElocation not on record | 1 |
| Claremont, US | 1 |
| UFPRlocation not on record | 1 |
| Juriquilla, MX | 1 |
| OTSlocation not on record | 1 |
| Honolulu, US | 1 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| UNESP-RClocation not on record | 1 |
| Moscow State Universitylocation not on record | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| Berea Collegelocation not on record | 1 |
| Provo, US | 1 |
| UTFPR-CPlocation not on record | 1 |
| UTFPR-SLlocation not on record | 1 |
| Londrina, BR | 1 |
| Campo Mourão, BR | 1 |
199 institutions · 2 847 of 2 886 vouchered records shown · 38 without an institution code
09Environmental DNA2 detections
Where the DNA of Cyperus surinamensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found2
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 2 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median22.7 °C 22.7–22.7
Seasonal swing summer↔winter17.4 °C
Max temp (day)27.6 °C
Min temp (night)18.9 °C
Precipitation74.4 mm/mo
Air humidity58.9 %
Moisture balance-106 mm/mo
Vapour deficit1,128 Pa
Wind speed4.00 m/s
Cloud cover37.9 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.