Cyperus strigosus
speciesAt a glance
Occurrence records8 938
Data sources10
Biological traits96
DNA specimens9
eDNA detections5
Sources10 archives
Databases and archives Cyperus strigosus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility8 938 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics9 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources96 traits
Occurrence & distributionGBIF8 938 records
Environmental DNA1 datasets · 2 countries5 detections
DNA & barcodingBOLD · NCBI9 specimens
01Narrative
Cyperus strigosus adalah spesies tumbuhan yang tergolong ke dalam famili Cyperaceae. Spesies ini juga merupakan bagian dari ordo Poales. Spesies Cyperus strigosus sendiri merupakan bagian dari genus Cyperus. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh L..
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology4
Plant height1 m
Seed mass0.346 mg
⚠ sources differ — TRY: 0.346 mg · GIFT: 0.326 mg
Seed mass max0.748 mg
Seed mass min0.06 mg
Life cycle & reproduction26
After harvest regrowth rateSlow
Bloom periodSummer
Coppice potentialNo
Deciduousnessn.d.
Flower colourbrown
Flower conspicuousNo
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifeform raunkiaer detailedgeophyte
Lifespan categoryLong
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedNo
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Resprout abilityNo
Seed spread rateModerate
Seedling vigorMedium
Vegetative spread rateSlow
Diet & foraging1
Parasiteindependent
Habitat & environment26
Active growth periodSpring
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureFine
Fruit colourred
Growth formherb
Growth form USDABunch
Habitat GIFTÁrea Antrópica
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza type0.000104004
Root depth min16 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry20
Anaerobic toleranceMedium
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantYes
Fire toleranceMedium
Frost free days min100 days
Leaf dry-matter content (LDMC)192 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Precipitation max60 in
Precipitation min16 in
Salinity toleranceNone
Shade toleranceHigh
Soil pH max7 pH
Soil pH min6.4 pH
Specific leaf area (SLA)30.64 mm²/mg
Temperature min-33 °F
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable graze animalMedium
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits6
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousYes
Fruit seed persistenceYes
Planting density max4 800 per acre
Planting density min3 450 per acre
05DNA & barcoding9 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyperus strigosus has left across the world's sequence archives.
At a glance
DNA specimens9
Marker genes5
GenBank sequences10
eDNA detections5
Countries2
The DNA barcodea real sequence read deposited for this species
TCGTTGCCCCGAAACACGACCGCGAACACGTAACGTAAAGCCGCCGGGGAGGGGCCTCCTCCCCGGACCCGCCGGCCCCGGCCCCTCGGC …
Cyperus strigosus voucher UNKAR9385 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK5★rbcL4★rbcLa★ITS1★ITS2
plant barcodefungal barcode
08Occurrence & distribution
Record type8 938 records
Wild obs. + sensor3 692
Museum / vouchered5 245
Other1
Origin
Native3
Range
Area of Occupancy AOO27 476 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy88% within 1 km
≤100 m 2 274≤1 km 320≤10 km 102>10 km 241
2 937 georeferenced · 755 without coordinates
Open the mapobservation + sensor3 692
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy44% within 1 km
≤100 m 322≤1 km 1 047≤10 km 1 541>10 km 201
3 111 georeferenced · 2 134 without coordinates
Open the institutions mapphysical evidence5 245
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions123 of 196 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Philadelphia, US | 573 |
| Chongqing Museumlocation not on record | 355 |
| Bronx, US | 301 |
| Madison, US | 234 |
| Wuzhou, CN | 185 |
| Jackson, US | 180 |
| Saint Louis, US | 151 |
| Bloomington, US | 147 |
| St. Paul, US | 114 |
| University of Stellenboschlocation not on record | 111 |
| Bangkok, TH | 109 |
| Valdosta State Universitylocation not on record | 106 |
| Fort Worth, US | 87 |
| Tampa, US | 87 |
| Williamsburg, US | 86 |
| Allentown, US | 84 |
| Burlington, US | 84 |
| Ann Arbor, US | 83 |
| University of New Hampshirelocation not on record | 74 |
| Austin, US | 72 |
| College Park, US | 71 |
| New Haven, US | 68 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 64 |
| International Salmonella Centre (W.H.O.)location not on record | 63 |
| Lincoln, US | 59 |
| Jena Microbial Resource Collectionlocation not on record | 49 |
| Pittsburg, US | 47 |
| BAYLUlocation not on record | 45 |
| Fayetteville, US | 44 |
| Columbia, US | 42 |
| Lord Fairfax Community Collegelocation not on record | 36 |
| Tuscaloosa, US | 35 |
| Chadron, US | 33 |
| Corvallis, US | 31 |
| Green Bay, US | 31 |
| WTUlocation not on record | 29 |
| Chapel Hill, US | 28 |
| Québec, CA | 27 |
| US | 27 |
| Knoxville, US | 25 |
| Montréal, CA | 25 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 25 |
| Philadelphia, US | 25 |
| Millersville, US | 25 |
| BIO-UNIPIlocation not on record | 24 |
| Miami, US | 24 |
| Morgantown, US | 24 |
| Pullman, US | 24 |
| Toronto, CA | 22 |
| Staten Island, US | 21 |
| New Brunswick, US | 21 |
| Mississippi State, US | 20 |
| GAlocation not on record | 19 |
| Flagstaff, US | 19 |
| Dekalb, US | 19 |
| San Angelo, US | 17 |
| Odawara, JP | 16 |
| Little Rock, US | 16 |
| Durham, US | 15 |
| Canadian Department of Agriculturelocation not on record | 14 |
| Norfolk, US | 14 |
| University of Southern Mississippilocation not on record | 14 |
| Montréal, CA | 13 |
| Moscow, US | 13 |
| Dover, US | 13 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 13 |
| Claremont, US | 12 |
| ASUlocation not on record | 12 |
| Asheville, US | 12 |
| Johnson City, US | 12 |
| Texas Lutheran Universitylocation not on record | 12 |
| Davenport, US | 11 |
| Henderson State Universitylocation not on record | 11 |
| Museum of the Rockieslocation not on record | 11 |
| San Diego, US | 11 |
| Boise, US | 10 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 10 |
| Riverside, US | 10 |
| Auckland, NZ | 10 |
| Hudson, US | 10 |
| Vancouver, CA | 9 |
| Davis, US | 9 |
| EL PASO, US | 9 |
| University of Tennessee at Chattanoogalocation not on record | 8 |
| AUAlocation not on record | 8 |
| Fairfax, US | 8 |
| Logan, US | 8 |
| BDBClocation not on record | 8 |
| Whitewater, US | 7 |
| Altos de Pipe, VE | 7 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 7 |
| GB | 7 |
| Richmond, US | 7 |
| Caldwell, US | 6 |
| Hamilton, US | 6 |
| China Agricultural Universitylocation not on record | 6 |
| Lubbock, US | 6 |
| Washington, US | 5 |
| Conway, US | 5 |
| Mohonk Preservelocation not on record | 5 |
| Edmonton, CA | 5 |
| Denton, US | 5 |
| Keene State Universitylocation not on record | 5 |
| Provo, US | 5 |
| DOI/NPS, Greenbelt Parklocation not on record | 5 |
| Kirksville, US | 5 |
| Santa Barbara, US | 5 |
| Phoenix, US | 5 |
| Mexico City, MX | 5 |
| US | 5 |
| Springfield, US | 5 |
| Royal Botanical Gardenslocation not on record | 4 |
| McWane Science Centerlocation not on record | 4 |
| University of Wisconsinlocation not on record | 4 |
| Minia, EG | 4 |
| Université Lavallocation not on record | 4 |
| Clemson, US | 4 |
| Northridge, US | 4 |
| Arcata, US | 3 |
| Angwin, US | 3 |
| Emporia, US | 3 |
| Elikins, US | 3 |
| Denver, US | 3 |
| Jefferson City, US | 3 |
| Christchurch, NZ | 3 |
| Weber State Universitylocation not on record | 3 |
| CASlocation not on record | 3 |
| Wellington, NZ | 3 |
| Portland, US | 3 |
| Dresden, DE | 3 |
| Chicago, US | 3 |
| University of North Carolina at Pembrokelocation not on record | 3 |
| BClocation not on record | 3 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 3 |
| UnBlocation not on record | 2 |
| IDElocation not on record | 2 |
| University of Winnipeglocation not on record | 2 |
| Portland, US | 2 |
| MAlocation not on record | 2 |
| Henderson, US | 2 |
| Tall Timbers Research Stationlocation not on record | 2 |
| North Carolina Museum of Natural Scienceslocation not on record | 2 |
| Missouri Department of Conservationlocation not on record | 2 |
| University of Alberta Museumslocation not on record | 2 |
| Chicago, US | 2 |
| Beijing, CN | 2 |
| Karlsruhe, DE | 2 |
| Pocatello, US | 2 |
| Tennessee Technological Universitylocation not on record | 2 |
| Clarksville, US | 2 |
| LDlocation not on record | 2 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 2 |
| Albuquerque, US | 2 |
| Turlock, US | 2 |
| Oswego, US | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Paris, FR | 2 |
| US | 2 |
| LINUlocation not on record | 2 |
| Moscow State Universitylocation not on record | 2 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Cambridge, US | 1 |
| Taipei, TW | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| Akita Prefectural Museumlocation not on record | 1 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 1 |
| GJOlocation not on record | 1 |
| Missoula, US | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| Walla Walla, US | 1 |
| University of Wisconsinlocation not on record | 1 |
| Mount Pleasant, US | 1 |
| Brookings, US | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| URCAlocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Whitehorse, CA | 1 |
| Long Beach, US | 1 |
| Russellville, US | 1 |
| CSBSJUlocation not on record | 1 |
| San Jose, US | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| VALElocation not on record | 1 |
| Wlocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| PRClocation not on record | 1 |
| Kew, GB | 1 |
| WINlocation not on record | 1 |
| Durango, US | 1 |
| State University of New York, Oneontalocation not on record | 1 |
| Kingston, US | 1 |
| Salamanca, ES | 1 |
| Göteborg, SE | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| Pomona Collegelocation not on record | 1 |
| Columbus State University Herbariumlocation not on record | 1 |
196 institutions · 5 086 of 5 245 vouchered records shown · 159 without an institution code
09Environmental DNA5 detections
Where the DNA of Cyperus strigosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found5
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 5 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.5 °C 16.0–20.9
Seasonal swing summer↔winter22.0 °C
Max temp (day)22.4 °C 20.7–24.1
Min temp (night)15.7 °C 13.0–18.4
Precipitation73.1 mm/mo 59.5–86.7
Air humidity58.8 % 57.9–59.6
Moisture balance-42.3 mm/mo -53.9–-30.7
Vapour deficit884 Pa 766–1,001
Wind speed3.70 m/s 3.30–4.00
Cloud cover40.0 % 38.3–41.7
CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.