Cyperus squarrosus
speciesAt a glance
Occurrence records6 061
Data sources10
Biological traits39
DNA specimens7
eDNA detections3
Sources10 archives
Databases and archives Cyperus squarrosus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility6 061 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics7 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources39 traits
Chemical compositionLOTUS7 compounds
Occurrence & distributionGBIF6 061 records
Environmental DNA1 datasets · 2 countries3 detections
DNA & barcodingBOLD · NCBI7 specimens
Genome at a glanceCCDB2n = 108
01Narrative
具芒鳞磚子苗（学名：）为莎草科莎草属下的一个种。它主要分佈於于云南、四川、非洲、喜马拉雅山区、尼泊尔、锡金、印度、越南等地。
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPAusTraitsTRYGIFT
Size & morphology9
Fruit length0.8 mm
Fruit width0.35 mm
Leaf width2 mm
Plant height0.15 m
Plant height max0.31 m
Plant height min0.02 m
Seed mass0.038 mg
⚠ sources differ — TRY: 0.038 mg · AusTraits: 0.04 mg · GIFT: 0.033 mg
Seed mass max0.04 mg
Seed mass min0.01 mg
Life cycle & reproduction12
Deciduousnessn.d.
Dehiscenceindehiscent
Dispersal typeanimal+water+wind
Flowering endJul
Flowering startJun
Flowering timeyynnnnnnyyyy
Life formannual
Life spanann
⚠ sources differ — TRY: ann · AusTraits: annual · GIFT: annual
Pollination syndromeinsect+wind
Raunkiær life formtherophyte
Resprouting capacityfire_killed
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 900 m
Elevation mean10 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typenut
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Floresta Ciliar ou Galeria, Vegetação Aquática
Leaf compoundnesssimple
Mycorrhiza type0.0000972
Woodinessnon-woody
Physiology & chemistry3
Leaf n21.84 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC4
03Chemical composition7 compounds
Compounds documented for Cyperus squarrosus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Noreudesmane sesquiterpenoids3
Aromatic polyketides with side chains1
Documented compounds7 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 2-Acetyl-4,8-dihydro-5-methylbenzo[1,2-b:5,4-b']difuran-4,8-dione | present | LOTUS | |
| 2-Prop-1-en-2-ylfuro[3,2-f][1]benzofuran-4,8-dione | present | LOTUS | |
| 3-[(Z)-heptadec-8-enyl]-2-hydroxy-5-methoxycyclohexa-2,5-diene-1,4-dione | present | LOTUS | |
| 5-Methyl-2-prop-1-en-2-yl-2,3,5,6-tetrahydrofuro[3,2-f][1]benzofuran-4,8-dione | present | LOTUS | |
| BENZO(1,2-b:5,4-b')DIFURAN-4,8-DIONE, 2,3-DIHYDRO-2-ISOPROPENYL-5-METHYL-, (-)- | present | LOTUS | |
| Benzo[1,2-b:5,4-b']difuran-4,8-dione, 2-[1-(hydroxymethyl)vinyl]-5-methyl- | present | LOTUS | |
| Cyperaquinone | present | LOTUS |
05DNA & barcoding7 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyperus squarrosus has left across the world's sequence archives.
At a glance
DNA specimens7
Marker genes5
GenBank sequences10
eDNA detections3
Countries3
The DNA barcodea real sequence read deposited for this species
TGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACC …
Cyperus squarrosus voucher CCDB-18345-H10 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL3★rbcLa★ITS4★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Cyperus squarrosus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 108 n = 54
Chromosome records98–1082n range108median108mode3records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1082×CCDB · cyper-only · CCDB · book-indian_vol2
CCDB · cyper-only — Nijalingappa, B. H. M., N. Nagaraj & D. H. Tejavathi1978
CCDB · book-indian_vol2 — Nijalingappa, B.H.M. et al. 1978
2n 981×CCDB · eflora
CCDB · eflora
n 496×CCDB · cyper-only · CCDB · ipcn-api-dl
CCDB · cyper-only — Bir, S. S., M. K. Sidhu & S. Kamra1981
CCDB · cyper-only — Bir, S. S., S. Kamra, M. K. Sidhu & P. Cheema1988b
CCDB · cyper-only — Bir, S. S., P. Cheema & M. K. Sidhu1990
CCDB · ipcn-api-dl — Bir, S. S., S. Kamra, M. Sidhu & P. Cheema. 1988. Cytomorphological studies on some members of Cyperaceae from north India. J. Cytol. Genet. 23: 14–37.
CCDB · ipcn-api-dl — Bir, S. S., P. Cheema & M. Sidhu. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 137–139.
CCDB · ipcn-api-dl — Bir, S. S., M. Sidhu & S. Kamra. 1981. In Chromosome number reports LXXIII. Taxon 30: 854.
n 542×CCDB · cyper-only · CCDB · ipcn-api-dl
CCDB · cyper-only — 235Nijalingappa, B. H. M., N. Nagaraj & D. H. Tejavathi1978
CCDB · ipcn-api-dl — Nijalingappa, B. H. M., N. NAGARAJ & D. H. TEJAVATHI. 1978. In IOPB chromosome number reports LXII. Taxon 27: 519–535.
08Occurrence & distribution
Record type6 061 records
Wild obs. + sensor1 461
Museum / vouchered4 518
Other82
Origin
Native263
Range
Area of Occupancy AOO17 808 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy70% within 1 km
≤100 m 729≤1 km 75≤10 km 179>10 km 166
1 149 georeferenced · 312 without coordinates
Open the mapobservation + sensor1 461
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy53% within 1 km
≤100 m 668≤1 km 624≤10 km 979>10 km 155
2 426 georeferenced · 2 092 without coordinates
Open the institutions mapphysical evidence4 518
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions147 of 235 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| St. Paul, US | 240 |
| Wuzhou, CN | 188 |
| Brisbane, AU | 177 |
| Palmerston, AU | 154 |
| Pretoria, ZA | 153 |
| Kensington, AU | 125 |
| Madison, US | 120 |
| San Diego, US | 117 |
| Adelaide, AU | 114 |
| Saint Louis, US | 106 |
| Austin, US | 86 |
| Mount Annan, AU | 85 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 79 |
| Museo Entomologico de Leonlocation not on record | 79 |
| ASUlocation not on record | 76 |
| Bloomington, US | 74 |
| Kew, GB | 74 |
| Philadelphia, US | 72 |
| Ann Arbor, US | 70 |
| Chongqing Museumlocation not on record | 64 |
| Canberra, AU | 64 |
| Flagstaff, US | 64 |
| Pullman, US | 63 |
| Corvallis, US | 60 |
| WTUlocation not on record | 58 |
| Bronx, US | 58 |
| Mexico City, MX | 56 |
| Riverside, US | 56 |
| Jackson, US | 56 |
| Claremont, US | 55 |
| International Salmonella Centre (W.H.O.)location not on record | 46 |
| Burlington, US | 40 |
| Guasave, MX | 39 |
| La Paz, MX | 34 |
| University of Stellenboschlocation not on record | 32 |
| Chadron, US | 31 |
| Durango, MX | 28 |
| Caldwell, US | 28 |
| Fort Worth, US | 27 |
| MeiseBGlocation not on record | 27 |
| Armidale, AU | 27 |
| Puerto Ayora, EC | 26 |
| Vancouver, CA | 25 |
| Lincoln, US | 24 |
| Davis, US | 24 |
| Jena Microbial Resource Collectionlocation not on record | 23 |
| EL PASO, US | 23 |
| Tampa, US | 23 |
| GMBAlocation not on record | 23 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 22 |
| New Haven, US | 22 |
| Masindi, UG | 21 |
| Phoenix, US | 21 |
| Missoula, US | 21 |
| Mérida, MX | 20 |
| Smithfield, AU | 20 |
| Universidade Federal de Sergipe (UFS)location not on record | 20 |
| Albuquerque, US | 20 |
| Santa Barbara, US | 19 |
| San Isidro, AR | 18 |
| Logan, US | 17 |
| Chapel Hill, US | 17 |
| San Angelo, US | 16 |
| Université de Bordeauxlocation not on record | 15 |
| Edinburgh, GB | 15 |
| UNIVASFlocation not on record | 15 |
| University of New Hampshirelocation not on record | 14 |
| UFPElocation not on record | 13 |
| Montréal, CA | 13 |
| Fayetteville, US | 13 |
| Austin, US | 12 |
| Bangkok, TH | 12 |
| CASlocation not on record | 12 |
| Green Bay, US | 12 |
| Moscow, US | 12 |
| US | 11 |
| Provo, US | 11 |
| Little Rock, US | 10 |
| Dekalb, US | 10 |
| Henderson, US | 10 |
| Pittsburg, US | 10 |
| National Museums of Kenyalocation not on record | 9 |
| HNBlocation not on record | 9 |
| Salvador, BR | 9 |
| Canadian Department of Agriculturelocation not on record | 9 |
| UFERSAlocation not on record | 8 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 8 |
| Laboratorio de Ictiologialocation not on record | 8 |
| Chaguaramas, TT | 8 |
| San Luis Obispo, US | 8 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 7 |
| UnBlocation not on record | 7 |
| DOI/NPS, Greenbelt Parklocation not on record | 7 |
| Xiamen, CN | 7 |
| BAYLUlocation not on record | 7 |
| Arcata, US | 7 |
| James Cook Townsvillelocation not on record | 6 |
| Ciudad de México, MX | 6 |
| DanBIFlocation not on record | 6 |
| Universidade Federal do Vale do São Franciscolocation not on record | 6 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 6 |
| Christchurch, NZ | 6 |
| Acadia Universitylocation not on record | 6 |
| Boise, US | 6 |
| Maryland Department of Natural Resourceslocation not on record | 6 |
| New Brunswick, US | 6 |
| Portland, US | 5 |
| BIO-UNIPIlocation not on record | 5 |
| VALElocation not on record | 5 |
| Valdosta State Universitylocation not on record | 5 |
| Tuscaloosa, US | 5 |
| AUAlocation not on record | 5 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 5 |
| Tall Timbers Research Stationlocation not on record | 5 |
| Denver, US | 5 |
| The University of Arizonalocation not on record | 5 |
| Spearfish, US | 5 |
| US | 5 |
| Victoria, CA | 5 |
| Philadelphia, US | 4 |
| Hobart, AU | 4 |
| UFBAlocation not on record | 4 |
| Saint John, CA | 4 |
| Columbia, US | 4 |
| GB | 4 |
| Fairfax, US | 4 |
| Ensenada, MX | 4 |
| Québec, CA | 4 |
| DULlocation not on record | 4 |
| Feira de Santana, BR | 4 |
| Morgantown, US | 4 |
| Museum of the Rockieslocation not on record | 3 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 3 |
| Mississippi State, US | 3 |
| Auckland, NZ | 3 |
| Beijing, CN | 3 |
| Durham, US | 3 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 3 |
| UFSClocation not on record | 3 |
| Severin-McDaniel Insect Collectionlocation not on record | 3 |
| College Park, US | 3 |
| Porto Alegre, BR | 3 |
| Hermosillo, MX | 3 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 3 |
| Millersville, US | 3 |
| University of Alberta Museumslocation not on record | 2 |
| Whitehorse, CA | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Universidade Federal de Santa Catarinalocation not on record | 2 |
| Mérida, MX | 2 |
| Fredericton Stock Culture Collectionlocation not on record | 2 |
| BMlocation not on record | 2 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 2 |
| Université Lavallocation not on record | 2 |
| San Francisco de Campeche, MX | 2 |
| Williamsburg, US | 2 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 2 |
| USP-IBlocation not on record | 2 |
| Paris, FR | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| Moscow State Universitylocation not on record | 2 |
| Montréal, CA | 2 |
| Uppsala, SE | 2 |
| Chicago, US | 2 |
| Pocatello, US | 2 |
| Bend, US | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| LINUlocation not on record | 2 |
| Tapachula, MX | 2 |
| Baroda, IN | 2 |
| Chapingo, MX | 2 |
| Oskarshamn, SE | 2 |
| Chicago, US | 2 |
| Guatemala, GT | 2 |
| Pomona Collegelocation not on record | 2 |
| Altos de Pipe, VE | 1 |
| Jefferson City, US | 1 |
| Elikins, US | 1 |
| Stockholm, SE | 1 |
| Macomb, US | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Fortaleza, BR | 1 |
| UFMGlocation not on record | 1 |
| Brasília, BR | 1 |
| Norfolk, US | 1 |
| HCIBlocation not on record | 1 |
| Clemson, US | 1 |
| Weber State Universitylocation not on record | 1 |
| Brasília, BR | 1 |
| NGCPR00999location not on record | 1 |
| Durham, US | 1 |
| Miami, US | 1 |
| JBRJlocation not on record | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| Taipei, TW | 1 |
| Lubbock, US | 1 |
| USONlocation not on record | 1 |
| Tacoma, US | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 1 |
| Clarksville, US | 1 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 1 |
| Calabar, NG | 1 |
| Cenargenlocation not on record | 1 |
| San Francisco, US | 1 |
| Orem, US | 1 |
| UFMSlocation not on record | 1 |
| Wlocation not on record | 1 |
| Herbier National du Gabonlocation not on record | 1 |
| Ypsilanti, US | 1 |
| New Mexico Museum of Natural History and Sciencelocation not on record | 1 |
| Dresden, DE | 1 |
| Frankfurt am Main | 1 |
| NSW Office of Environment and Heritagelocation not on record | 1 |
| GAlocation not on record | 1 |
| Arizona State University Biocollectionslocation not on record | 1 |
| Turku, FI | 1 |
| McWane Science Centerlocation not on record | 1 |
| South Kensington, GB | 1 |
| Los Angeles, US | 1 |
| Kathmandu, NP | 1 |
| Texas Lutheran Universitylocation not on record | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| Denton, US | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| Ashland, US | 1 |
| Knoxville, US | 1 |
| Toluca, MX | 1 |
| Aarhus, DK | 1 |
| Dehra Dun, IN | 1 |
| Northridge, US | 1 |
| Honolulu, US | 1 |
235 institutions · 4 340 of 4 518 vouchered records shown · 178 without an institution code
09Environmental DNA3 detections
Where the DNA of Cyperus squarrosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found3
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 3 detections have coordinates
Open the map2 countries0
Riparian/Oak Woodland with Baccharis salicif…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median20.7 °C 18.4–22.9
Seasonal swing summer↔winter24.9 °C
Max temp (day)26.8 °C 23.2–30.4
Min temp (night)16.2 °C 15.6–16.8
Precipitation46.2 mm/mo 18.9–73.4
Air humidity54.9 % 51.2–58.7
Moisture balance-97.9 mm/mo -151–-44.5
Vapour deficit1,132 Pa 888–1,376
Wind speed2.70 m/s 2.60–2.90
Cloud cover26.5 % 15.1–37.9
CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.