Cyperus rotundus
speciesAt a glance
Occurrence records17 118
Data sources16
Biological traits57
DNA specimens53
eDNA detections52
Sources16 archives
Databases and archives Cyperus rotundus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility17 103 records↗
OBISOcean Biodiversity Information System15 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI52 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics53 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources57 traits
Chemical compositionLOTUS · NPASS370 compounds
Occurrence & distributionGBIF · OBIS17 118 records
Environmental DNA2 datasets · 10 countries52 detections
DNA & barcodingBOLD · NCBI53 specimens
Genome at a glanceCCDB · GIFT · GoaT489 Mbp
01Narrative
Cyperus rotundus, le souchet rond, est une espèce de plantes monocotylédones de la famille des Cyperaceae, originaire de l'Inde. C'est une plante herbacée vivace à rhizomes et tubercules, qui peut atteindre une hauteur de 1,40 m, qui croît dans tous les types de sol mais ne tolère pas le froid et l'ombre. Elle est nommée Souchet rond, Souchet d'Asie, Souchet officinal, Herbe à oignon ou Souchet à tubercule. Originaire d'Inde, elle s'est développée de l'Afrique au sud de l'Europe, puis a étendu son aire de répartition sur une grande partie de la planète. Dans les régions tropicales et tempérées chaudes, elle représente un véritable fléau pour beaucoup de cultures. Ses tubercules sont utilisés à des fins médicinales et alimentaires.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYAusTraitsLEDAGIFTWCVP
Size & morphology18
Fruit length1.5 mm
Fruit length max1.5 mm
Fruit length min1.2 mm
Fruit width0.5 mm
Fruit width max0.7 mm
Fruit width min0.4 mm
Inflorescence length max12 cm
Leaf length max300 mm
Leaf length min1 mm
Leaf width4 mm
⚠ sources differ — AusTraits: 4 mm · GIFT: 3 mm
Leaf width max5 mm
Leaf width min1 mm
Plant height0.373 m
⚠ sources differ — GIFT: 0.373 m · AusTraits: 0.225 m · TRY: 0.25 m
Plant height max1 m
Plant height min0 m
Seed mass0.255 mg
⚠ sources differ — TRY: 0.255 mg · GIFT: 0.226 mg
Seed mass max0.367 mg
Seed mass min0.041 mg
Life cycle & reproduction19
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typewater
Flower colourbrown
Flower length max4.3 mm
Flower length min2.6 mm
Flower width max3 mm
Flower width min0.7 mm
Flowering endSep
Flowering startApr
Flowering timeyynnnnnnyyyy
Life formtuberous geophyte
Life spanperennial
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formcryptophyte
Reproduction asexualpresent
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatesubtropical
Climberself-supporting
Elevation max2 300 m
Elevation min0 m
Epiphyteterrestrial
Fruit colourblack
Fruit typenut
⚠ sources differ — AusTraits: nut · GIFT: achene
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb
Habitat GIFTÁrea Antrópica, Floresta Ciliar ou Galeria, Vegetação Aquática
Leaf compoundnesssimple
Mycorrhiza type0.0000976
Succulenceno
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC4
Other traits3
Inflorescencepanicle
Seeds per fruit101-1000
Shoot orientationerect
03Chemical composition370 compounds
Compounds documented for Cyperus rotundus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Eudesmane sesquiterpenoids37
Aromadendrane sesquiterpenoids33
Pinane monoterpenoids28
Cadinane sesquiterpenoids28
Menthane monoterpenoids $ Monocyclic monoterpenoids22
Documented compounds370 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-1(10),4-Cadinadiene | present | LOTUS | |
| (+)-alpha-Bulgarene | present | LOTUS | |
| (+)-alpha-Cyperone | present | LOTUS | |
| (+)-alpha-Muurolene | present | NPASS | |
| (+)-alpha-Pinene | present | NPASS | |
| (+)-Camphene | present | LOTUS | |
| (+)-cis-Carveol | present | NPASS | |
| (+)-Delta-cadinol | present | NPASS | |
| (+)-gamma-Bulgarene | present | LOTUS | |
| (+)-gamma-Eudesmol | present | LOTUS |
05DNA & barcoding53 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyperus rotundus has left across the world's sequence archives.
At a glance
DNA specimens53
Marker genes8
GenBank sequences10
eDNA detections52
Countries10
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTGGGCGTTAGAAGCCC …
Cyperus rotundus voucher FEAD20 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK3★rbcL5★rbcLa★trnL★ITS2★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Cyperus rotundus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size489 000 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Cyperus rotundus0.49 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 108 n = 54
Ploidy2× diploid · measured
Chromosome records16–1522n range100median108mode31records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 10811×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +3
CCDB · cyper-only — Heiser, C. B. & T. W. Whitaker1948
CCDB · cyper-only — Tanaka, N.1948
CCDB · cyper-only — Sharma, A. K.1970
CCDB · cyper-only — Sanyal, B. & A. Sharma1972b
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn72 — SANYAL, B. 1972. Cytological studies on Indian Cyperaceae II. Tribe Cypereae. Cytologia 37: 33-42.
CCDB · book-indian_vol2 — Tanaka, N.-1948 (Jinno, T. 1956b) ; Heiser, C.B. & Whitaker, T.W. 1948; Sanyal, B. 1972
CCDB · book-fedorov — Tanaka N. 1937, 1948
CCDB · book-fedorov — Jinno 1956b)
CCDB · book-fedorov — Heiser, Whitaker 1948
GIFT · GIFT (floras)
2n 165×CCDB · cyper-only · CCDB · book-ipcn67-71 · CCDB · book-indian_vol2 +2
CCDB · cyper-only — Hsu, C.-C.1967
CCDB · book-ipcn67-71 — HSU, C.-c. 1967. Preliminary chromosome studies on the vascular plants of Taiwan (I). Taiwania No. 13: 117-130.
CCDB · book-indian_vol2 — Hsu, C.-C. 1967
CCDB · CromoCat 2015 — Hsu, C. -C. (1967). Preliminary chromosome studies on the vascular plants of Taiwan (I). Taiwania 13: 117-130.
GIFT · GIFT (floras)
2n 265×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-indian_vol2 +2
CCDB · cyper-only — Sarkar, A. K., R. Mallick, N. Dutta & U. Chatterjee1977
CCDB · ipcn-api-dl
CCDB · book-indian_vol2 — Sarkar, A.K., Chakraverty, M. et al. 1977
CCDB · CromoCat 2015 — Sarkar, A. K., M. Chakraverty, N. C. Saha, S. K. Das & D. Hazra. (1977a). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LVII]. Taxon 26(4): 450.
GIFT · GIFT (floras)
2n 1523×CCDB · cyper-only · CCDB · book-indian_vol2 · GIFT · GIFT (floras)
CCDB · cyper-only — Rath, S. P. & S. N. Patnaik1978a
CCDB · book-indian_vol2 — Rath, S.P. & Patnaik, S.N. 1975, 1978a
GIFT · GIFT (floras)
2n 842×CCDB · book-indian_vol2 · GIFT · GIFT (floras)
CCDB · book-indian_vol2 — Rath, S.P. et al. 1973
GIFT · GIFT (floras)
2n 962×CCDB · book-indian_vol2 · GIFT · GIFT (floras)
CCDB · book-indian_vol2 — Mehra, P.N. & Sachdeva, S.K. 1971, 1975a
GIFT · GIFT (floras)
2n 361×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Baquar, S. R. (1969). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXIV]. Taxon 18(5): 683.
2n 1001×GIFT · GIFT (floras)
GIFT · GIFT (floras)
2n 1281×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 486×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · cyper-only — Mehra, P. N. & S. K. Sachdeva1971
CCDB · cyper-only — Mehra, P. N. & S. K. Sachdeva1975b
CCDB · ipcn-api-dl — Mehra, P. N. & S. K. Sachdeva. 1975. Cytology of some west Himalayan Cyperaceae. Cytologia 40: 497–515.
CCDB · book-ipcn67-71 — MEHRA, P.N . & S.K. SACHDEVA. 1971. In IOPB chromosome reports XXXIII. Taxon 20: 609-614.
CCDB · book-ipcn75-78 — Mehra & Sachdeva 1975
CCDB · CromoCat 2015 — Mehra, P. N. & S. K. Sachdeva. (1971). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXIII]. Taxon 20(4): 611-613.
n 504×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · cyper-only — Bir, S. S. & C. Singh1983
CCDB · ipcn-api-dl — Bir, S. S. & C. Singh. 1983. SOCGI plant chromosome number reports -- I. J. Cytol. Genet. 18: 60–61.
CCDB · ipcn-api-dl — Bir, S. S., M. Sidhu & S. Kamra. 1981. In Chromosome number reports LXXIII. Taxon 30: 854.
CCDB · CromoCat 2015 — Bir, S. S., Sidhu, M. & Kamra, S. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 854-855.
n 544×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1
CCDB · cyper-only — Sharma, A. K.1970
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn75-78 — Sharma 1970
CCDB · CromoCat 2015 — Bir, S. S., Cheema, P., Sidhu, M. (1990). SOCGI plant chromosome number reports---IX Journal of Cytology and Genetics 25: 137-139
n 423×CCDB · cyper-only · CCDB · book-ipcn73-74 · CCDB · CromoCat 2015
CCDB · cyper-only — Rath, S. P., J. Mohapara & S. N. Patnaik1973
CCDB · book-ipcn73-74 — RATH, S.P., J. MOHAPATRA, & S.N. PATNAIK. 1973. Cytotaxonomic studies in the genus Cyperus L. ( s .1.). Proc. Indian Sci. Congr. 'Assoc. 60: 314-316.
CCDB · CromoCat 2015 — Bir, S. S., Cheema, P., Sidhu, M. (1990). SOCGI plant chromosome number reports---IX Journal of Cytology and Genetics 25: 137-139
n 763×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78
CCDB · cyper-only — Rath, S. P. & S. N. Patnaik1975
CCDB · ipcn-api-dl — Rath, S. P. & S. N. PATNAIK. 1975. Cytological studies in Cyperaceae. Proc. Indian Sci. Congr. Assoc. 62: 127–128.
CCDB · book-ipcn75-78 — Rath & Patnaik 1975
n 72×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · CromoCat 2015 — Khatoon, S. & Ali, S. I. (1993). Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi
n 401×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bir, S. S., Chatha, G. S. & Sidhu, M. (1992). Intraspecific variation in Cyperaceae from Punjab Plain, India Willdenowia 22: 133-142
n 521×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bir, S. S., Cheema, P., Sidhu, M. (1990). SOCGI plant chromosome number reports---IX Journal of Cytology and Genetics 25: 137-139
n 551×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bir, S. S., Cheema, P., Sidhu, M. (1990). SOCGI plant chromosome number reports---IX Journal of Cytology and Genetics 25: 137-139
n 561×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bir, S. S., Chatha, G. S. & Sidhu, M. (1992). Intraspecific variation in Cyperaceae from Punjab Plain, India Willdenowia 22: 133-142
n 581×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bir, S. S., Cheema, P., Sidhu, M. (1990). SOCGI plant chromosome number reports---IX Journal of Cytology and Genetics 25: 137-139
n 641×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bir, S. S., Sidhu, M. & Kamra, S. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 854-855.
n 661×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bir, S. S., Cheema, P., Sidhu, M. (1990). SOCGI plant chromosome number reports---IX Journal of Cytology and Genetics 25: 137-139
n 691×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bir, S. S., Chatha, G. S. & Sidhu, M. (1992). Intraspecific variation in Cyperaceae from Punjab Plain, India Willdenowia 22: 133-142
n 801×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Bir, S. S., Cheema, P., Sidhu, M. (1990). SOCGI plant chromosome number reports---IX Journal of Cytology and Genetics 25: 137-139
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
08Occurrence & distribution
Record type17 118 records
Wild obs. + sensor9 675
Museum / vouchered6 988
Cultivated / captive4
Other451
Origin
Native597
Introduced698
Range
Area of Occupancy AOO37 988 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy68% within 1 km
≤100 m 2 447≤1 km 1 825≤10 km 1 704>10 km 292
6 268 georeferenced · 3 407 without coordinates
Open the mapobservation + sensor9 675
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy55% within 1 km
≤100 m 550≤1 km 455≤10 km 707>10 km 131
1 843 georeferenced · 5 145 without coordinates
Open the institutions mapphysical evidence6 988
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1
1 georeferenced · 3 without coordinates
Open the mapnot free-living4
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions227 of 481 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 230 |
| Brisbane, AU | 174 |
| Durango, MX | 158 |
| Kew, GB | 157 |
| Guangzhou, CN | 142 |
| Taipei, TW | 141 |
| Bronx, US | 119 |
| Chiba, JP | 116 |
| Mount Annan, AU | 106 |
| LDlocation not on record | 106 |
| BIO-UNIPIlocation not on record | 105 |
| Odawara, JP | 103 |
| Beijing, CN | 93 |
| Jackson, US | 89 |
| Yangling, CN | 89 |
| Mexico City, MX | 83 |
| Fort Worth, US | 79 |
| Kochi, JP | 75 |
| Nagatoro-machi, Chichibu-gun, JP | 69 |
| Porto Alegre, BR | 68 |
| València, ES | 61 |
| MeiseBGlocation not on record | 61 |
| Guilin, CN | 57 |
| Austin, US | 57 |
| Canberra, AU | 57 |
| Sanda, JP | 55 |
| Barcelona, ES | 55 |
| TAIElocation not on record | 54 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 54 |
| National Biodiversity Institute, Costa Ricalocation not on record | 54 |
| Palmerston, AU | 51 |
| Berlin, DE | 50 |
| Kunming, CN | 50 |
| Auckland, NZ | 49 |
| Adelaide, AU | 48 |
| GMBAlocation not on record | 47 |
| Tampa, US | 47 |
| MAlocation not on record | 46 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 46 |
| Université de Bordeauxlocation not on record | 45 |
| San Isidro, AR | 44 |
| University of Stellenboschlocation not on record | 44 |
| Christchurch, NZ | 44 |
| BDBClocation not on record | 41 |
| Baroda, IN | 40 |
| UnBlocation not on record | 40 |
| Museo Entomologico de Leonlocation not on record | 40 |
| Altos de Pipe, VE | 39 |
| Universidade Federale do Rio Grande do Sullocation not on record | 38 |
| Bando, JP | 34 |
| LaCarto/IGATE/UAClocation not on record | 32 |
| Taipei, TW | 31 |
| Xinxiang, CN | 31 |
| Jena Microbial Resource Collectionlocation not on record | 30 |
| Nanjing, CN | 28 |
| Ann Arbor, US | 28 |
| BClocation not on record | 27 |
| Kensington, AU | 27 |
| ISAlocation not on record | 25 |
| ASUlocation not on record | 24 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 24 |
| Armidale, AU | 24 |
| PUC-RSlocation not on record | 23 |
| Frankfurt am Main | 23 |
| US | 23 |
| Moscow State Universitylocation not on record | 21 |
| Valdosta State Universitylocation not on record | 21 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 20 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 20 |
| Hazara Universitylocation not on record | 20 |
| CICYTEXlocation not on record | 19 |
| 黔东南州民族医药研究所标本室location not on record | 19 |
| Jaén, ES | 19 |
| Tokushima, JP | 19 |
| Canadian Department of Agriculturelocation not on record | 19 |
| Paris, FR | 18 |
| WAGlocation not on record | 18 |
| Changsha, CN | 18 |
| Pondicherry, IN | 18 |
| College of the Atlantic, Museumlocation not on record | 18 |
| Miami, US | 18 |
| Toyama, JP | 17 |
| Culiacán, MX | 17 |
| Bangkok, TH | 17 |
| Flagstaff, US | 17 |
| Zhengzhou, CN | 16 |
| Tomioka, JP | 16 |
| Salvador, BR | 16 |
| Ciudad de México, MX | 16 |
| IBANNlocation not on record | 16 |
| Smithfield, AU | 16 |
| Mexico City, MX | 16 |
| Forest Herbarium Ibadan (FHI)location not on record | 16 |
| Riverside, US | 15 |
| South Kensington, GB | 15 |
| Antiguo Cuscatlán, SV | 15 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 15 |
| Córdoba, AR | 15 |
| Xiamen, CN | 14 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 14 |
| Granada, ES | 14 |
| Montecillo, Texcoco, MX | 14 |
| Plocation not on record | 14 |
| Claremont, US | 14 |
| Williamsburg, US | 14 |
| Alicante, ES | 14 |
| UNIVASFlocation not on record | 13 |
| Guasave, MX | 13 |
| HNBlocation not on record | 13 |
| Honolulu, US | 13 |
| Muzaffarabad, PK | 13 |
| Uppsala, SE | 13 |
| Tuscaloosa, US | 13 |
| Santa Barbara, US | 13 |
| National Museums of Kenyalocation not on record | 13 |
| UFBAlocation not on record | 13 |
| Awka, NG | 13 |
| Wlocation not on record | 13 |
| BRNUlocation not on record | 12 |
| University of Papua New Guinealocation not on record | 12 |
| National Marine Biodiversity Institute of Korealocation not on record | 12 |
| San Diego, US | 12 |
| Lanzhou, CN | 12 |
| Davis, US | 12 |
| EL PASO, US | 12 |
| BISHlocation not on record | 12 |
| Taipei, TW | 11 |
| Université du Lomélocation not on record | 11 |
| Córdoba, ES | 11 |
| Ischia Marine Centrelocation not on record | 11 |
| Zapopan, MX | 11 |
| Université de Strasbourglocation not on record | 11 |
| 河南豫北黄河故道湿地鸟类国家级自然保护区location not on record | 11 |
| Badajoz, ES | 11 |
| JBRJlocation not on record | 11 |
| Laboratorio de Ictiologialocation not on record | 11 |
| Istituto Agrario Castelnuovolocation not on record | 11 |
| Nagasaki University - Fisherieslocation not on record | 11 |
| GAlocation not on record | 10 |
| Phyletisches Museum Jenalocation not on record | 10 |
| CJBGlocation not on record | 10 |
| Masindi, UG | 10 |
| Logan, US | 10 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 10 |
| Hangzhou, CN | 10 |
| Seoul, KR | 10 |
| Hobart, AU | 10 |
| St. Augustine, TT | 10 |
| Mississippi State, US | 10 |
| Austin, US | 9 |
| Philadelphia, US | 9 |
| Edinburgh, GB | 9 |
| Hermosillo, MX | 9 |
| UIBlocation not on record | 9 |
| Wellington, NZ | 9 |
| SXTCMlocation not on record | 9 |
| Peking Universitylocation not on record | 9 |
| Juriquilla, MX | 9 |
| UFSClocation not on record | 8 |
| Fayetteville, US | 8 |
| León, NI | 8 |
| Dresden, DE | 8 |
| Knoxville, US | 8 |
| Blumenau, BR | 8 |
| Yaoundé, CM | 8 |
| GB | 8 |
| Denton, US | 8 |
| San Angelo, US | 8 |
| NSMKlocation not on record | 8 |
| Columbia, US | 8 |
| BAYLUlocation not on record | 8 |
| KURAlocation not on record | 8 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 8 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 8 |
| Bloomington, US | 8 |
| Chengdu, CN | 7 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 7 |
| Vancouver, CA | 7 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 7 |
| Universidade Federal de Sergipe (UFS)location not on record | 7 |
| Chongqing Museumlocation not on record | 7 |
| 盐城国家级珍禽自然保护区location not on record | 7 |
| Osaka, JP | 7 |
| Torreón, MX | 7 |
| Stockholm, SE | 7 |
| Wuzhou, CN | 7 |
| Parthenon Tama History Museumlocation not on record | 7 |
| Phoenix, US | 7 |
| Pontifícia Universidade Católica do Paranálocation not on record | 6 |
| Entomological Society of Latvialocation not on record | 6 |
| Universidad Nacional de Colombia (UNAL)location not on record | 6 |
| Pullman, US | 6 |
| Sendai, JP | 6 |
| Olocation not on record | 6 |
| Universidad de Caldas (UCaldas)location not on record | 6 |
| Kagoshima, JP | 6 |
| Glocation not on record | 6 |
| UFERSAlocation not on record | 6 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 6 |
| Universidade Federal de Santa Catarinalocation not on record | 6 |
| CNF-UFHBlocation not on record | 6 |
| Uniwersytet Śląski w Katowicachlocation not on record | 6 |
| 云南省思茅市民族传统医药研究所location not on record | 6 |
| Xian, CN | 6 |
| John T. Waterhouse Herbariumlocation not on record | 6 |
| Conservatoire Botanique National de Mascarinlocation not on record | 6 |
| Addis Ababa, ET | 6 |
| GJOlocation not on record | 6 |
| Kawasaki Shi Tama Ku, JP | 6 |
| Zacatecas, MX | 6 |
| Guangzhou, CN | 6 |
| Salamanca, ES | 5 |
| Mérida, MX | 5 |
| San Luis Obispo, US | 5 |
| Sagamihara, JP | 5 |
| San José, CR | 5 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 5 |
| Jishou Universitylocation not on record | 5 |
| La Paz, MX | 5 |
| Sevilla, ES | 5 |
| FJIDClocation not on record | 5 |
| University of Southern Mississippilocation not on record | 5 |
| UNESP-ISlocation not on record | 5 |
| UFPElocation not on record | 5 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 5 |
| Tsukuba, JP | 5 |
| AUAlocation not on record | 5 |
| UFMSlocation not on record | 5 |
| Université National du Béninlocation not on record | 5 |
| Chapingo, MX | 5 |
| Ciudad de México, MX | 4 |
| Cuiabá, BR | 4 |
| Beijing, CN | 4 |
| Texas Lutheran Universitylocation not on record | 4 |
| EFGlocation not on record | 4 |
| Herbier National du Gabonlocation not on record | 4 |
| Chapel Hill, US | 4 |
| DSMlocation not on record | 4 |
| UEMAlocation not on record | 4 |
| Zhejiang Museum of Natural Historylocation not on record | 4 |
| LSFlocation not on record | 4 |
| Guatemala, GT | 4 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| Chaguaramas, TT | 4 |
| Museo Achille Folettolocation not on record | 4 |
| J.F.Oberlin Universitylocation not on record | 4 |
| UNESP-FCAlocation not on record | 4 |
| EAlocation not on record | 4 |
| Feira de Santana, BR | 4 |
| IECOSlocation not on record | 4 |
| CEPLAClocation not on record | 4 |
| Guiyang, CN | 4 |
| PRClocation not on record | 4 |
| JP | 4 |
| Smithsonian Institution, National Museum of Natural History, United States National Herbariumlocation not on record | 4 |
| James Cook Townsvillelocation not on record | 3 |
| Clocation not on record | 3 |
| CASlocation not on record | 3 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 3 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 3 |
| Puerto Ayora, EC | 3 |
| Rotorua, NZ | 3 |
| Dekalb, US | 3 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 3 |
| Sharjah Research Academy, Seed Bank and Herbariumlocation not on record | 3 |
| Norfolk, US | 3 |
| OTSlocation not on record | 3 |
| UFSJlocation not on record | 3 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 3 |
| UNESP-FCAVlocation not on record | 3 |
| Universidade Federal do Vale do São Franciscolocation not on record | 3 |
| CC BYlocation not on record | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| Hunan Geological Museumlocation not on record | 3 |
| Adam Mickiewicz University in Poznańlocation not on record | 3 |
| TAFORI-LSRClocation not on record | 3 |
| Guatemala City, GT | 3 |
| Durham, US | 3 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 3 |
| Loja, EC | 3 |
| Görlitz, DE | 3 |
| Tianjin Natural History Museumlocation not on record | 3 |
| Dehra Dun, IN | 3 |
| IPA/SPlocation not on record | 3 |
| Haramaya Universitylocation not on record | 3 |
| Montréal, CA | 3 |
| Aarhus, DK | 3 |
| Mazatlán, MX | 2 |
| Bourges, FR | 2 |
| Valparaíso, CL | 2 |
| Tapachula, MX | 2 |
| Cascavel, BR | 2 |
| Chicago, US | 2 |
| New Brunswick, US | 2 |
| UNESP, Campus São José Rio Prêtolocation not on record | 2 |
| Cambridge, US | 2 |
| Lubbock, US | 2 |
| New Haven, US | 2 |
| Brasília, BR | 2 |
| San Francisco de Campeche, MX | 2 |
| Campo Mourão, BR | 2 |
| Minia, EG | 2 |
| UFMGlocation not on record | 2 |
| Shanghai, CN | 2 |
| Universidade Federal do Espírito Santolocation not on record | 2 |
| The Maharaja Sayajirao University of Barodalocation not on record | 2 |
| Sociedad Para el Estudio de los Recursos Bioticos de Oaxacalocation not on record | 2 |
| ESALQlocation not on record | 2 |
| Toronto, CA | 2 |
| University of Bayreuthlocation not on record | 2 |
| Northridge, US | 2 |
| Provo, US | 2 |
| Brussels, BE | 2 |
| IAPlocation not on record | 2 |
| UEMlocation not on record | 2 |
| Beijing Natural History Museumlocation not on record | 2 |
| SIHUlocation not on record | 2 |
| HAWlocation not on record | 2 |
| Cambridge University Herbariumlocation not on record | 2 |
| KR | 2 |
| Staten Island, US | 2 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 2 |
| Shanxi Universitylocation not on record | 2 |
| Yunnan Universitylocation not on record | 2 |
| EEZA-CSIClocation not on record | 2 |
| Jiujiang Forestry Institutelocation not on record | 2 |
| Zhejiang Universitylocation not on record | 2 |
| UEPAlocation not on record | 2 |
| Burlington, US | 2 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 2 |
| Durham, US | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Pamplona, ES | 2 |
| Gujarat Biodiversity Gene Banklocation not on record | 2 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 2 |
| Museo Athanasius Kircher di Romalocation not on record | 2 |
| Universidad Pablo de Olavidelocation not on record | 2 |
| Nishihara, JP | 2 |
| Autlán de Navarro, MX | 2 |
| Tall Timbers Research Stationlocation not on record | 2 |
| Santa Cruz de la Sierra, BO | 2 |
| Arusha, TZ | 2 |
| UTFPR-CPlocation not on record | 2 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 2 |
| Departamento de Sistematica e Ecologialocation not on record | 2 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 2 |
| UFPRlocation not on record | 2 |
| Long Beach, US | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| Oiso Municipal Museumlocation not on record | 1 |
| Eduardo Mondlane Universitylocation not on record | 1 |
| UC_PESHlocation not on record | 1 |
| University of Hamburglocation not on record | 1 |
| Los Angeles, US | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Lake Charles, US | 1 |
| LISClocation not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| UNICAMPlocation not on record | 1 |
| Santa Teresa, BR | 1 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 1 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| TNMlocation not on record | 1 |
| Universidad Nacional de Misiones- CONICETlocation not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Little Rock, US | 1 |
| Shanxi Institute of Biologylocation not on record | 1 |
| Shenzhen, CN | 1 |
| Universidade de São Paulolocation not on record | 1 |
| Federal University of Espírito Santolocation not on record | 1 |
| Morelia, MX | 1 |
| Xian, CN | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| Xining, CN | 1 |
| Capital Normal Universitylocation not on record | 1 |
| Toyota city nature sanctuarylocation not on record | 1 |
| Ilhéus, BR | 1 |
| Seychelles National Herbariumlocation not on record | 1 |
| Shenyang Agricultural Universitylocation not on record | 1 |
| Taiyuan Normal Universitylocation not on record | 1 |
| Guiyang, CN | 1 |
| Davenport, US | 1 |
| Sharjah Seed Bank & Herbariumlocation not on record | 1 |
| UFESlocation not on record | 1 |
| FUVATESlocation not on record | 1 |
| Mount Pleasant, US | 1 |
| JBSlocation not on record | 1 |
| Centro de Biotecnologia e Quimica-CEBIQlocation not on record | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Provincia di Livornolocation not on record | 1 |
| Parkville, AU | 1 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 1 |
| La Paz, BO | 1 |
| Wollongong, AU | 1 |
| Pomona Collegelocation not on record | 1 |
| ILLSlocation not on record | 1 |
| Fredericksburg, US | 1 |
| National Natural History Collectionslocation not on record | 1 |
| Universidad Nacional Agrarialocation not on record | 1 |
| Tempe, US | 1 |
| Zürich, CH | 1 |
| Arcata, US | 1 |
| Fukushima Universitylocation not on record | 1 |
| Collections de la Faculte des Sciences de Lyonlocation not on record | 1 |
| UFABClocation not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| Cenargenlocation not on record | 1 |
| Vitoria, ES | 1 |
| Londrina, BR | 1 |
| UNESClocation not on record | 1 |
| GENTlocation not on record | 1 |
| UFOPlocation not on record | 1 |
| Chadron, US | 1 |
| Conway, US | 1 |
| UEGlocation not on record | 1 |
| UNITINSlocation not on record | 1 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 1 |
| Obihiro Centennial City Museumlocation not on record | 1 |
| UTPLlocation not on record | 1 |
| Sucre, BO | 1 |
| Pretoria, ZA | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record | 1 |
| Göteborg, SE | 1 |
| BMlocation not on record | 1 |
| Sangmiung Universitylocation not on record | 1 |
| Leiden University Medical Centerlocation not on record | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Henderson State Universitylocation not on record | 1 |
| Conway, US | 1 |
| Gump Stationlocation not on record | 1 |
| Wuhan, CN | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| JGSlocation not on record | 1 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 1 |
| J. Rusek Collectionlocation not on record | 1 |
| Hanshan Normal Universitylocation not on record | 1 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 1 |
| Maringá, BR | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| UNESP-RClocation not on record | 1 |
| Lincoln, US | 1 |
| Rishon Le Zion, IL | 1 |
| UFRPElocation not on record | 1 |
| Bogotá, D.C., CO | 1 |
| Mlocation not on record | 1 |
| Batemans Bay, AU | 1 |
| Centre National des Semences Forestièreslocation not on record | 1 |
| La Trobe Universitylocation not on record | 1 |
| INMAlocation not on record | 1 |
| St. Paul, US | 1 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| Universidad del Valle (UV)location not on record | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| Universidade Federal de Goiáslocation not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| University of Zhejianglocation not on record | 1 |
| Universidad de Córdoba (UniCórdoba)location not on record | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| Pennsylvania Department of Agriculturelocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Mexico City, MX | 1 |
| HUENFlocation not on record | 1 |
| ESP010location not on record | 1 |
| Due West, US | 1 |
| URCAlocation not on record | 1 |
| Santiago de Compostela, ES | 1 |
| Fortaleza, BR | 1 |
| UFRRJlocation not on record | 1 |
| Brasília, BR | 1 |
| Oskarshamn, SE | 1 |
| Chicago, US | 1 |
| Coimbra, PT | 1 |
| Albuquerque, US | 1 |
| ENTClocation not on record | 1 |
481 institutions · 6 324 of 6 988 vouchered records shown · 645 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA52 detections
Where the DNA of Cyperus rotundus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found52
Studies independent surveys2
Countries10
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 52 detections have coordinates
Open the map10 countries0
Side of riverKLEE; Disturbed areas of Acacia drepanolobiu…Grasslandweed in lawn. Quite abundant in landscaping …
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median21.9 °C 15.7–26.5
Seasonal swing summer↔winter3.90 °C
Max temp (day)26.2 °C 20.8–28.5
Min temp (night)17.8 °C 10.2–22.9
Precipitation211 mm/mo 21.1–245
Air humidity61.1 % 52.7–61.5
Moisture balance58.9 mm/mo -95.7–89.3
Vapour deficit1,015 Pa 827–1,168
Wind speed3.00 m/s 2.40–4.50
Cloud cover52.1 % 20.7–56.0
CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.