Cyperus odoratus
speciesAt a glance
Occurrence records12 984
Data sources8
Biological traits125
DNA specimens38
eDNA detections17
Sources8 archives
Databases and archives Cyperus odoratus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility12 976 records↗
OBISOcean Biodiversity Information System8 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics38 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
WikidataWikimedia Foundationstructured facts↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources125 traits
Occurrence & distributionGBIF · OBIS12 984 records
Environmental DNA1 datasets · 5 countries17 detections
DNA & barcodingBOLD · NCBI38 specimens
01Narrative
02Traits & measurements
SourcesWCVPTRYAusTraitsGIFTUSDA
Size & morphology18
Fruit length1.65 mm
Fruit length max1.9 mm
Fruit length min1 mm
Fruit width0.65 mm
Fruit width max750 mm
Fruit width min0.5 mm
Inflorescence length max2 cm
Inflorescence length min1 cm
Leaf length max300 mm
Leaf length min50 mm
Leaf width max12 mm
Leaf width min4 mm
Plant height0.61 m
⚠ sources differ — GIFT: 0.61 m · USDA: 0.61 m · TRY: 0.705 m
Plant height max1 m
Plant height min0.05 m
Seed mass0.09 mg
⚠ sources differ — TRY: 0.09 mg · AusTraits: 0.269 mg · GIFT: 0.09 mg
Seed mass max0.09 mg
Seed mass min0.09 mg
Life cycle & reproduction32
After harvest regrowth rateSlow
Bloom periodLate Summer
Coppice potentialNo
Deciduousnessn.d.
Dehiscenceindehiscent
Dispersal typewater
Flower colourbrown
Flower conspicuousNo
Flowering endSep
Flowering startAug
Flowering timeyynnnnnnnnny
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formannual or perennial
Life spanAnnual, Perennial
⚠ sources differ — TRY: Annual, Perennial · AusTraits: annual perennial · GIFT: perennial
Lifespan categoryShort
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedNo
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formtherophyte
Resprout abilityNo
Seed spread rateModerate
Seedling vigorHigh
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment32
Active growth periodSummer and Fall
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 900 m
Elevation mean920 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureFine
Fruit colourblack
Fruit fleshinessdry
Fruit typenut
⚠ sources differ — AusTraits: nut · GIFT: achene
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb
Growth form USDABunch
Habitat GIFTÁrea Antrópica, Floresta Ciliar ou Galeria, Palmeiral, Vegetação Aquática
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionNo
Low growing grassNo
Root depth min8 in
Shape and orientationErect
Small grainNo
Succulenceno
Woodinessnon-woody
Physiology & chemistry23
Anaerobic toleranceMedium
C:N ratioMedium
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceNone
Frost free days min80 days
Leaf C:N ratio29.83 g/g
Leaf c446 mg/g
Leaf n14.96 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC4
Precipitation max55 in
Precipitation min18 in
Salinity toleranceMedium
Shade toleranceHigh
Soil pH max8.3 pH
Soil pH min5 pH
Specific leaf area (SLA)17.36 mm²/mg
Temperature min42 °F
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits6
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceYes
Planting density max4 800 per acre
Planting density min3 450 per acre
05DNA & barcoding38 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyperus odoratus has left across the world's sequence archives.
At a glance
DNA specimens38
Marker genes6
GenBank sequences10
eDNA detections17
Countries6
The DNA barcodea real sequence read deposited for this species
TCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTTGCCTCGAAACANGACCGCGAACACGTAACGTAAAGCCTCCGG …
Cyperus odoratus voucher Pereira-Silva, L. 366 (FLOR) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL6★rbcLa★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
08Occurrence & distribution
Record type12 984 records
Wild obs. + sensor4 857
Museum / vouchered8 067
Other60
Origin
Native826
Range
Area of Occupancy AOO29 632 km²
Depth
0–200 m sunlit8
200–1000 m twilight0
1–4 km midnight0
>4 km abyssal0
median 1 m · max 1 m · 8 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy84% within 1 km
≤100 m 1 772≤1 km 322≤10 km 266>10 km 138
2 498 georeferenced · 2 359 without coordinates
Open the mapobservation + sensor4 857
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy57% within 1 km
≤100 m 810≤1 km 604≤10 km 890>10 km 182
2 486 georeferenced · 5 581 without coordinates
Open the institutions mapphysical evidence8 067
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions189 of 383 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 821 |
| Wuzhou, CN | 409 |
| Bronx, US | 396 |
| Durango, MX | 287 |
| St. Paul, US | 233 |
| Austin, US | 175 |
| ASUlocation not on record | 153 |
| University of Stellenboschlocation not on record | 143 |
| Porto Alegre, BR | 143 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 141 |
| Philadelphia, US | 131 |
| Tampa, US | 127 |
| National Biodiversity Institute, Costa Ricalocation not on record | 122 |
| Bloomington, US | 111 |
| San Diego, US | 102 |
| Ann Arbor, US | 102 |
| Fort Worth, US | 95 |
| Madison, US | 92 |
| Mexico City, MX | 92 |
| Altos de Pipe, VE | 89 |
| Riverside, US | 87 |
| Ciudad de México, MX | 84 |
| Claremont, US | 73 |
| Universidade Federale do Rio Grande do Sullocation not on record | 73 |
| UNIVASFlocation not on record | 72 |
| Université de Bordeauxlocation not on record | 72 |
| Jena Microbial Resource Collectionlocation not on record | 71 |
| Flagstaff, US | 65 |
| US | 64 |
| Kew, GB | 62 |
| Chongqing Museumlocation not on record | 62 |
| International Salmonella Centre (W.H.O.)location not on record | 60 |
| UFMSlocation not on record | 56 |
| Masindi, UG | 50 |
| San Isidro, AR | 50 |
| Durham, US | 48 |
| Universidad de Caldas (UCaldas)location not on record | 47 |
| UFPElocation not on record | 47 |
| Xiamen, CN | 45 |
| Paleontological Collectionlocation not on record | 44 |
| Miami, US | 43 |
| Salvador, BR | 43 |
| Jackson, US | 40 |
| Universidade Federal de Sergipe (UFS)location not on record | 40 |
| Mérida, MX | 39 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 38 |
| Corrientes, AR | 38 |
| Chiba, JP | 37 |
| Universidad Nacional de Colombia (UNAL)location not on record | 35 |
| St. Augustine, TT | 34 |
| Chadron, US | 33 |
| Bangkok, TH | 33 |
| Pittsburg, US | 33 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 32 |
| Santa Barbara, US | 29 |
| Guasave, MX | 29 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 29 |
| Mount Annan, AU | 28 |
| UFERSAlocation not on record | 28 |
| Paris, FR | 27 |
| UnBlocation not on record | 27 |
| Chaguaramas, TT | 27 |
| Brisbane, AU | 27 |
| Toyama, JP | 26 |
| Albuquerque, US | 26 |
| TAIElocation not on record | 26 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 25 |
| Lubbock, US | 25 |
| Antiguo Cuscatlán, SV | 25 |
| Phoenix, US | 24 |
| UFBAlocation not on record | 24 |
| PUC-RSlocation not on record | 24 |
| Bando, JP | 24 |
| UFSClocation not on record | 23 |
| DULlocation not on record | 23 |
| JBRJlocation not on record | 23 |
| Columbia, US | 22 |
| Universidade Federal de Santa Catarinalocation not on record | 21 |
| Canadian Department of Agriculturelocation not on record | 21 |
| Laboratorio de Ictiologialocation not on record | 21 |
| Aarhus, DK | 20 |
| Puerto Ayora, EC | 20 |
| Toronto, CA | 20 |
| EL PASO, US | 19 |
| Sagamihara, JP | 19 |
| New Haven, US | 19 |
| Córdoba, AR | 18 |
| Juriquilla, MX | 18 |
| León, NI | 18 |
| San Angelo, US | 18 |
| Mississippi State, US | 16 |
| Williamsburg, US | 16 |
| Texas Lutheran Universitylocation not on record | 16 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 16 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 16 |
| MAlocation not on record | 15 |
| Irvine, US | 15 |
| Philadelphia, US | 15 |
| QCNElocation not on record | 15 |
| Armidale, AU | 15 |
| Museu Paraense Emílio Goeldilocation not on record | 15 |
| Cenargenlocation not on record | 15 |
| Chicago, US | 14 |
| BAYLUlocation not on record | 14 |
| Odawara, JP | 14 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 14 |
| Burlington, US | 14 |
| CASlocation not on record | 14 |
| CEPLAClocation not on record | 13 |
| Brasília, BR | 13 |
| Santa Cruz de la Sierra, BO | 13 |
| Knoxville, US | 13 |
| Tuscaloosa, US | 13 |
| BIO-UNIPIlocation not on record | 13 |
| Morgantown, US | 12 |
| Logan, US | 12 |
| GB | 12 |
| Longwood Universitylocation not on record | 12 |
| UTFPR-CPlocation not on record | 11 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 11 |
| Feira de Santana, BR | 11 |
| Davis, US | 11 |
| Ciudad de México, MX | 11 |
| UFRPElocation not on record | 11 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 10 |
| Auckland, NZ | 10 |
| San José, CR | 10 |
| Mérida, MX | 10 |
| La Paz, MX | 10 |
| Norfolk, US | 10 |
| Blumenau, BR | 10 |
| Valdosta State Universitylocation not on record | 10 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 9 |
| Lincoln, US | 9 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 9 |
| College Park, US | 9 |
| GAlocation not on record | 9 |
| Campo Mourão, BR | 9 |
| Denton, US | 9 |
| Taipei, TW | 8 |
| Nagatoro-machi, Chichibu-gun, JP | 8 |
| Brasília, BR | 8 |
| INMAlocation not on record | 8 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 8 |
| UNICAMPlocation not on record | 8 |
| Departamento de Sistematica e Ecologialocation not on record | 8 |
| Chicago, US | 8 |
| Allentown, US | 8 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 8 |
| Provo, US | 7 |
| Lord Fairfax Community Collegelocation not on record | 7 |
| Mexico City, MX | 7 |
| Londrina, BR | 7 |
| Universidad Nacional Agrarialocation not on record | 7 |
| Cuiabá, BR | 7 |
| Chapel Hill, US | 7 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 7 |
| Sanda, JP | 6 |
| Montréal, CA | 6 |
| Sangmiung Universitylocation not on record | 6 |
| Berlin, DE | 6 |
| UEPAlocation not on record | 6 |
| University of Tennessee at Chattanoogalocation not on record | 6 |
| Museo Entomologico de Leonlocation not on record | 6 |
| UEMlocation not on record | 6 |
| AUAlocation not on record | 6 |
| MEXUlocation not on record | 6 |
| HNBlocation not on record | 6 |
| Tuxtla Gutiérrez, MX | 6 |
| Los Angeles, US | 6 |
| Dekalb, US | 6 |
| BISHlocation not on record | 6 |
| BDBClocation not on record | 6 |
| Henderson State Universitylocation not on record | 6 |
| Denver, US | 6 |
| UFMGlocation not on record | 6 |
| USP-IBlocation not on record | 6 |
| Emporia, US | 6 |
| Maringá, BR | 5 |
| Canberra, AU | 5 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 5 |
| Palmerston, AU | 5 |
| IECOSlocation not on record | 5 |
| South Kensington, GB | 5 |
| DOI/NPS, Greenbelt Parklocation not on record | 5 |
| Fayetteville, US | 5 |
| MeiseBGlocation not on record | 5 |
| FUVATESlocation not on record | 5 |
| Clemson, US | 5 |
| Universidade Federal do Vale do São Franciscolocation not on record | 5 |
| Austin, US | 5 |
| Fortaleza, BR | 5 |
| VENlocation not on record | 5 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 4 |
| Criciúma, BR | 4 |
| Cambridge, US | 4 |
| Whitewater, US | 4 |
| Tlalnepantla, MX | 4 |
| Little Rock, US | 4 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 4 |
| University of New Hampshirelocation not on record | 4 |
| UFPRlocation not on record | 4 |
| University of Southern Mississippilocation not on record | 4 |
| Catalina Island Conservancylocation not on record | 4 |
| Istituto Agrario Castelnuovolocation not on record | 4 |
| McWane Science Centerlocation not on record | 4 |
| Tapachula, MX | 4 |
| UNESClocation not on record | 4 |
| Honolulu, US | 4 |
| WTUlocation not on record | 4 |
| La Paz, BO | 4 |
| Universidade Federal do Maranhãolocation not on record | 4 |
| BMlocation not on record | 4 |
| Sucre, BO | 4 |
| Zacatecas, MX | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| University of North Carolina at Pembrokelocation not on record | 4 |
| Museum of Zoologylocation not on record | 3 |
| Museum of the Rockieslocation not on record | 3 |
| UTPLlocation not on record | 3 |
| IPA/SPlocation not on record | 3 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 3 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 3 |
| Ivano-Frankivsk, UA | 3 |
| Foz do Iguaçu, BR | 3 |
| Universidad Industrial de Santander (UIS)location not on record | 3 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 3 |
| New Brunswick, US | 3 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 3 |
| Mexico City, MX | 3 |
| Pontifícia Universidade Católica do Paranálocation not on record | 3 |
| Montecillo, Texcoco, MX | 3 |
| IAPlocation not on record | 3 |
| Moscow State Universitylocation not on record | 3 |
| Cochabamba, BO | 3 |
| Hermosillo, MX | 3 |
| Millersville, US | 3 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 3 |
| UNITINSlocation not on record | 3 |
| COLlocation not on record | 3 |
| UNESP-FCAlocation not on record | 3 |
| Ishikawa Museum of Natural Historylocation not on record | 3 |
| Station d'Ecologie de Lamtolocation not on record | 3 |
| Jefferson City, US | 3 |
| CPATSAlocation not on record | 3 |
| Stockholm, SE | 2 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 2 |
| OTSlocation not on record | 2 |
| Cambridge University Herbariumlocation not on record | 2 |
| ESALQlocation not on record | 2 |
| Oskarshamn, SE | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| Vancouver, CA | 2 |
| Guatemala, GT | 2 |
| Chapingo, MX | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| TNMlocation not on record | 2 |
| San Luis Potosí, MX | 2 |
| Christchurch, NZ | 2 |
| Dover, US | 2 |
| Fundación Estación Biológica Guayacanallocation not on record | 2 |
| Calabar, NG | 2 |
| Jataí / Setor Industrial, BR | 2 |
| Santa Teresa, BR | 2 |
| Loja, EC | 2 |
| Edinburgh, GB | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| BG-NMNHSlocation not on record | 2 |
| Wlocation not on record | 2 |
| Collections de la Faculte des Sciences de Lyonlocation not on record | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| Clocation not on record | 2 |
| Osaka, JP | 2 |
| HACAMlocation not on record | 2 |
| Universidad de Córdoba (UniCórdoba)location not on record | 2 |
| UFAClocation not on record | 2 |
| Nishihara, JP | 2 |
| Universidad Nacional de Asunciónlocation not on record | 2 |
| Ilhéus, BR | 2 |
| CUVClocation not on record | 2 |
| Durham, US | 2 |
| US | 2 |
| Giardini Botanici Hanburylocation not on record | 2 |
| Universidad de Córdoba (UC)location not on record | 2 |
| UTFPR-SLlocation not on record | 2 |
| The University of Arizonalocation not on record | 2 |
| UFOPlocation not on record | 2 |
| Río Palenque Science Centerlocation not on record | 2 |
| València, ES | 2 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 2 |
| Universiti Sains Malaysialocation not on record | 2 |
| North Carolina Museum of Natural Scienceslocation not on record | 2 |
| Angwin, US | 2 |
| Spearfish, US | 2 |
| Green Bay, US | 2 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 2 |
| Beijing, CN | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| Guatemala City, GT | 1 |
| China Agricultural Universitylocation not on record | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| USONlocation not on record | 1 |
| Hobart, AU | 1 |
| LINUlocation not on record | 1 |
| LGlocation not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| Russellville, US | 1 |
| NO DISPONIBLElocation not on record | 1 |
| Plocation not on record | 1 |
| HUAlocation not on record | 1 |
| Barcelona, ES | 1 |
| Minister of Sustainable Development, Climate Change & Solid Waste Managementlocation not on record | 1 |
| Teresina, BR | 1 |
| Zürich, CH | 1 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Edmonton, CA | 1 |
| Taipei, TW | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| UFSJlocation not on record | 1 |
| Universidad de los Llanos (UniLlanos)location not on record | 1 |
| Springfield, US | 1 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 1 |
| Lima, PE | 1 |
| UDESC-CAVlocation not on record | 1 |
| HUT Culture Collectionlocation not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| UNESP-IBILCElocation not on record | 1 |
| UEMAlocation not on record | 1 |
| Eastern Illinois Universitylocation not on record | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| UEGlocation not on record | 1 |
| UTFPR-DVlocation not on record | 1 |
| Salamanca, ES | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 1 |
| Adelaide, AU | 1 |
| Universidad de Guayaquillocation not on record | 1 |
| Universidade do Estado de Santa Catarinalocation not on record | 1 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 1 |
| Herbario de la Universidad Técnica del Nortelocation not on record | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| Universidade de São Paulolocation not on record | 1 |
| Agriculture and Agri-Food Canada, Vascular Plant Herbariumlocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Nagano City, JP | 1 |
| HEMlocation not on record | 1 |
| Zapopan, MX | 1 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 1 |
| Long Beach, US | 1 |
| Smithfield, AU | 1 |
| Puebla, MX | 1 |
| Autlán de Navarro, MX | 1 |
| Tomioka, JP | 1 |
| Corvallis, US | 1 |
| Buenos Aires, AR | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| UFVJMlocation not on record | 1 |
| Universidad de Pamplona (UPamplona)location not on record | 1 |
| Tempe, US | 1 |
| Federal University of Espírito Santolocation not on record | 1 |
| Science Museum of Minnesotalocation not on record | 1 |
| Oswego, US | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Minia, EG | 1 |
| Fairfax, US | 1 |
| Porto Velho, BR | 1 |
| Santarém, BR | 1 |
| Bogotá, D.C., CO | 1 |
| Mexico City, MX | 1 |
| URCAlocation not on record | 1 |
| Universidade Tecnológica Federal do Paranálocation not on record | 1 |
| Pullman, US | 1 |
| UFESlocation not on record | 1 |
| Pelotas, BR | 1 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 1 |
| Quito, EC | 1 |
| Northridge, US | 1 |
383 institutions · 7 869 of 8 067 vouchered records shown · 197 without an institution code
09Environmental DNA17 detections
Where the DNA of Cyperus odoratus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found17
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 17 detections have coordinates
Open the map5 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.8 °C 13.3–26.9
Seasonal swing summer↔winter25.1 °C
Max temp (day)21.6 °C 16.6–30.0
Min temp (night)17.2 °C 9.80–23.7
Precipitation117 mm/mo 52.8–338
Air humidity60.2 % 59.6–66.9
Moisture balance8.90 mm/mo -74.5–218
Vapour deficit861 Pa 645–1,206
Wind speed3.30 m/s 1.20–4.70
Cloud cover44.7 % 18.0–54.9
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.