Cyperus luzulae
(L.) Retz. · speciesAt a glance
Occurrence records4 766
Data sources7
Biological traits18
DNA specimens19
eDNA detections60
Sources7 archives
Databases and archives Cyperus luzulae's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 766 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI60 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics19 specimens↗
NCBIUS National Library of Medicinesequences↗
Open Tree of LifeOpenTreephylogeny backbone↗
WikidataWikimedia Foundationstructured facts↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources18 traits
Occurrence & distributionGBIF4 766 records
Environmental DNA2 datasets · 2 countries60 detections
DNA & barcodingBOLD · NCBI19 specimens
01Narrative
Cyperus luzulae adalah spesies tumbuhan yang tergolong ke dalam famili Cyperaceae. Spesies ini juga merupakan bagian dari ordo Poales. Spesies Cyperus luzulae sendiri merupakan bagian dari genus Cyperus. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh (L.) Retz..
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPTRYGIFT
Size & morphology3
Seed mass0.052 mg
Seed mass max0.05 mg
Seed mass min0.05 mg
Life cycle & reproduction4
Deciduousnessevergreen
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifeform raunkiaer detailedgeophyte
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 000 m
Elevation min0 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTÁrea Antrópica, Caatinga (stricto sensu), Campo Limpo, Floresta Ciliar ou Galeria, Floresta de Igapó, Floresta de Várzea, Floresta Ombrófila Mista, Restinga, Savana Amazônica, Vegetação Aquática
Woodinessnon-woody
Physiology & chemistry1
Specific leaf area (SLA)12.65 mm²/mg
05DNA & barcoding19 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyperus luzulae has left across the world's sequence archives.
At a glance
DNA specimens19
Marker genes6
GenBank sequences10
eDNA detections60
Countries2
The DNA barcodea real sequence read deposited for this species
TCGTTGCCTTCGAACACGACCGGCGAACACGTAACACAAAGCCATCGGGGAGGGTCACCCTCCCCGACCCCACGGCCCCGGCCTTCCGGT …
Cyperus luzulae voucher LSU:Reid 7808 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL7★rbcLa★ITS2★ITS2rpoC1
plant barcodefungal barcodemarker
08Occurrence & distribution
Record type4 766 records
Wild obs. + sensor830
Museum / vouchered3 836
Cultivated / captive1
Other99
Origin
Native609
Range
Area of Occupancy AOO10 476 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy86% within 1 km
≤100 m 251≤1 km 52≤10 km 27>10 km 23
353 georeferenced · 477 without coordinates
Open the mapobservation + sensor830
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy65% within 1 km
≤100 m 209≤1 km 44≤10 km 106>10 km 28
387 georeferenced · 3 449 without coordinates
Open the institutions mapphysical evidence3 836
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions92 of 233 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 711 |
| Bronx, US | 286 |
| Université de Bordeauxlocation not on record | 165 |
| National Biodiversity Institute, Costa Ricalocation not on record | 165 |
| University of Stellenboschlocation not on record | 129 |
| Durango, MX | 129 |
| Mexico City, MX | 111 |
| Porto Alegre, BR | 98 |
| Altos de Pipe, VE | 83 |
| Universidad Nacional de Colombia (UNAL)location not on record | 69 |
| Kew, GB | 67 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 65 |
| UnBlocation not on record | 59 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 54 |
| JBRJlocation not on record | 41 |
| UFPElocation not on record | 39 |
| Cenargenlocation not on record | 36 |
| Museu Paraense Emílio Goeldilocation not on record | 35 |
| Durham, US | 34 |
| Chaguaramas, TT | 34 |
| Xiamen, CN | 31 |
| Brasília, BR | 31 |
| Salvador, BR | 28 |
| UNICAMPlocation not on record | 28 |
| UFMSlocation not on record | 26 |
| Aarhus, DK | 25 |
| San José, CR | 25 |
| Brasília, BR | 25 |
| Universidade Federal de Santa Catarinalocation not on record | 24 |
| UFSClocation not on record | 24 |
| PUC-RSlocation not on record | 22 |
| Ann Arbor, US | 21 |
| Cuiabá, BR | 21 |
| León, NI | 20 |
| Blumenau, BR | 19 |
| UFMGlocation not on record | 19 |
| Austin, US | 19 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 19 |
| UFESlocation not on record | 19 |
| San Isidro, AR | 19 |
| Universidade Federale do Rio Grande do Sullocation not on record | 18 |
| Federal University of Espírito Santolocation not on record | 18 |
| IPA/SPlocation not on record | 17 |
| UFBAlocation not on record | 16 |
| Laboratorio de Ictiologialocation not on record | 16 |
| UEPAlocation not on record | 16 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 16 |
| Universidad de Caldas (UCaldas)location not on record | 14 |
| Paris, FR | 14 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 14 |
| QCNElocation not on record | 14 |
| MAlocation not on record | 13 |
| USP-IBlocation not on record | 12 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 12 |
| Tampa, US | 12 |
| Departamento de Sistematica e Ecologialocation not on record | 11 |
| Santa Cruz de la Sierra, BO | 11 |
| South Kensington, GB | 10 |
| Chicago, US | 10 |
| Berlin, DE | 9 |
| Feira de Santana, BR | 9 |
| Museum of Zoologylocation not on record | 9 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 9 |
| Area de Conservacion Guanacastelocation not on record | 8 |
| Stockholm, SE | 8 |
| La Paz, BO | 8 |
| VENlocation not on record | 7 |
| INMAlocation not on record | 7 |
| LDlocation not on record | 7 |
| Loja, EC | 7 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 7 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 6 |
| Universidad de los Andes (UniAndes)location not on record | 6 |
| Universidad de La Salle (La Salle)location not on record | 6 |
| Istituto Agrario Castelnuovolocation not on record | 6 |
| Santa Teresa, BR | 6 |
| Cambridge, US | 6 |
| Tapachula, MX | 6 |
| Fort Worth, US | 6 |
| Ivano-Frankivsk, UA | 6 |
| UFPRlocation not on record | 6 |
| Chongqing Museumlocation not on record | 6 |
| Londrina, BR | 6 |
| Mérida, MX | 5 |
| Campo Mourão, BR | 5 |
| Universidade Federal do Maranhãolocation not on record | 5 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 5 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 5 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 5 |
| UFRPElocation not on record | 5 |
| Bogotá, D.C., CO | 5 |
| Antiguo Cuscatlán, SV | 5 |
| CEPLAClocation not on record | 5 |
| UNESClocation not on record | 5 |
| UNESP-RClocation not on record | 5 |
| ASUlocation not on record | 5 |
| UTFPR-CPlocation not on record | 5 |
| UNIVASFlocation not on record | 5 |
| Universidade Federal de Goiáslocation not on record | 5 |
| UFSJlocation not on record | 5 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 5 |
| Universidad Nacional Agrarialocation not on record | 5 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 5 |
| Guasave, MX | 5 |
| GB | 5 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 5 |
| Criciúma, BR | 4 |
| IECOSlocation not on record | 4 |
| arosemena tola, EC | 4 |
| Ural Federal University "B. N. Yeltsin"location not on record | 4 |
| Ilhéus, BR | 4 |
| GeoPark Colombia S.A.S (GeoPark)location not on record | 4 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 4 |
| Universiti Sains Malaysialocation not on record | 4 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 4 |
| UNITINSlocation not on record | 4 |
| Station d'Ecologie de Lamtolocation not on record | 4 |
| Austin, US | 4 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 3 |
| Lima, PE | 3 |
| Fortaleza, BR | 3 |
| Chapingo, MX | 3 |
| OTSlocation not on record | 3 |
| Pontifícia Universidade Católica do Paranálocation not on record | 3 |
| EL PASO, US | 3 |
| Maringá, BR | 3 |
| ESALQlocation not on record | 3 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 3 |
| Davis, US | 3 |
| BMlocation not on record | 3 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 3 |
| Ciudad de México, MX | 3 |
| Teresina, BR | 3 |
| UNESP-ISlocation not on record | 3 |
| Sangmiung Universitylocation not on record | 3 |
| FUVATESlocation not on record | 3 |
| HUAlocation not on record | 3 |
| Auckland, NZ | 3 |
| Collections de la Faculte des Sciences de Lyonlocation not on record | 3 |
| Universidade Federal do Vale do São Franciscolocation not on record | 3 |
| Universidade de São Paulolocation not on record | 3 |
| Sucre, BO | 3 |
| COLlocation not on record | 2 |
| FPMZBlocation not on record | 2 |
| Herbario de la Universidad Tecnológica Indoaméricalocation not on record | 2 |
| UNESP, Campus São José Rio Prêtolocation not on record | 2 |
| HUT Culture Collectionlocation not on record | 2 |
| Calabar, NG | 2 |
| UEMAlocation not on record | 2 |
| Riverside, US | 2 |
| Plocation not on record | 2 |
| Pullman, US | 2 |
| Guatemala City, GT | 2 |
| Universidad de los Llanos (UniLlanos)location not on record | 2 |
| UTFPR-SLlocation not on record | 2 |
| Minister of Sustainable Development, Climate Change & Solid Waste Managementlocation not on record | 2 |
| Cochabamba, BO | 2 |
| CASlocation not on record | 2 |
| Madison, US | 2 |
| Cusco, PE | 2 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 2 |
| IAvHlocation not on record | 2 |
| Lake Charles, US | 2 |
| Ciudad de México, MX | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 2 |
| UFAClocation not on record | 2 |
| Universidad Industrial de Santander (UIS)location not on record | 2 |
| Toronto, CA | 2 |
| Fundación Estación Biológica Guayacanallocation not on record | 2 |
| Vancouver, CA | 2 |
| Paleontological Collectionlocation not on record | 2 |
| Universidad de Córdoba (UniCórdoba)location not on record | 1 |
| CJBGlocation not on record | 1 |
| UNEMATlocation not on record | 1 |
| UNESP-IBILCElocation not on record | 1 |
| Alcaldía Municipal de Garzón en Huilalocation not on record | 1 |
| Denver, US | 1 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Beijing, CN | 1 |
| Mexico City, MX | 1 |
| Mérida, MX | 1 |
| Mlocation not on record | 1 |
| Cruz das Almas, BR | 1 |
| CPATSAlocation not on record | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| Santarém, BR | 1 |
| UNESP-FCAlocation not on record | 1 |
| UFERSAlocation not on record | 1 |
| Eastern Illinois Universitylocation not on record | 1 |
| Clocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Campo Grande, BR | 1 |
| UFSCarlocation not on record | 1 |
| Moscow State Universitylocation not on record | 1 |
| Forest Herbarium Ibadan (FHI)location not on record | 1 |
| Denton, US | 1 |
| LGlocation not on record | 1 |
| UEGlocation not on record | 1 |
| Uberlândia, BR | 1 |
| IAPlocation not on record | 1 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 1 |
| UEMlocation not on record | 1 |
| Monastir, TN | 1 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 1 |
| MeiseBGlocation not on record | 1 |
| UNICAPlocation not on record | 1 |
| US | 1 |
| Mexico City, MX | 1 |
| Dresden, DE | 1 |
| UTPLlocation not on record | 1 |
| San Francisco de Campeche, MX | 1 |
| Cambridge, US | 1 |
| Burlington, US | 1 |
| Norfolk, US | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| CUVClocation not on record | 1 |
| QAPlocation not on record | 1 |
| LBVlocation not on record | 1 |
| Jataí / Setor Industrial, BR | 1 |
| BRLUlocation not on record | 1 |
| Coimbra, PT | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Iquitos, PE | 1 |
| Universidad de Córdoba (UC)location not on record | 1 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 1 |
| Río Palenque Science Centerlocation not on record | 1 |
| Santiago de Cali, CO | 1 |
| Riobamba, EC | 1 |
| MEXUlocation not on record | 1 |
| Universidade Federal de Sergipe (UFS)location not on record | 1 |
233 institutions · 3 662 of 3 836 vouchered records shown · 174 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA60 detections
Where the DNA of Cyperus luzulae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found60
Studies independent surveys2
Countries2
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 60 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.2 °C 17.2–23.0
Seasonal swing summer↔winter12.3 °C
Max temp (day)21.6 °C 21.6–25.9
Min temp (night)13.6 °C 13.5–20.7
Precipitation127 mm/mo 126–182
Air humidity61.4 % 58.7–64.4
Moisture balance39.0 mm/mo 9.90–59.6
Vapour deficit759 Pa 754–1,021
Wind speed4.00 m/s 3.10–4.70
Cloud cover35.6 % 30.6–36.6
CHELSA 1981–2010, ~9 km grid, at location & month of 58 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.