Cyperus ligularis
speciesAt a glance
Occurrence records5 252
Data sources9
Biological traits16
DNA specimens5
eDNA detections4
Sources9 archives
Databases and archives Cyperus ligularis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility5 249 records↗
OBISOcean Biodiversity Information System3 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics5 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources16 traits
Occurrence & distributionGBIF · OBIS5 252 records
Environmental DNA1 datasets · 1 countries4 detections
DNA & barcodingBOLD · NCBI5 specimens
Genome at a glanceCCDB2n = 50
01Narrative
سايبروس ليجولاريس هو نوع من نبات البردي موطنه الأجزاء الجنوبية من أمريكا الشمالية وأمريكا الوسطى والأجزاء الشمالية من أمريكا الجنوبية وكذلك على طول الساحل الشرقي لأفريقيا.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology1
Seed mass0.388 mg
Life cycle & reproduction4
Dispersal typeanimal
Life formperennial
Life spanperennial
Raunkiær life formcryptophyte
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 000 m
Elevation min0 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTCaatinga (stricto sensu), Floresta Ciliar ou Galeria, Vegetação Aquática
Woodinessnon-woody
Physiology & chemistry1
Photosynthetic pathwayC4
05DNA & barcoding5 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyperus ligularis has left across the world's sequence archives.
At a glance
DNA specimens5
Marker genes5
GenBank sequences10
eDNA detections4
Countries1
The DNA barcodea real sequence read deposited for this species
TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTCGCCTCGAAACACGACCGCGAACACGTAACGTAAAAGCCGCCGGGGAGGTGCCT …
Cyperus ligularis voucher Pereira-Silva, L. 223 (FLOR) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK5★rbcL2★rbcLa★ITS3★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Cyperus ligularis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 50 n = 25
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 501×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 31
08Occurrence & distribution
Record type5 252 records
Wild obs. + sensor2 287
Museum / vouchered2 798
Other167
Origin
Native438
Introduced24
Range
Area of Occupancy AOO11 036 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy92% within 1 km
≤100 m 1 352≤1 km 226≤10 km 68>10 km 71
1 717 georeferenced · 570 without coordinates
Open the mapobservation + sensor2 287
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy79% within 1 km
≤100 m 413≤1 km 16≤10 km 69>10 km 48
546 georeferenced · 2 252 without coordinates
Open the institutions mapphysical evidence2 798
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions99 of 213 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 298 |
| Durango, MX | 197 |
| Bronx, US | 162 |
| Mexico City, MX | 146 |
| Tampa, US | 95 |
| University of Stellenboschlocation not on record | 64 |
| Kew, GB | 64 |
| National Biodiversity Institute, Costa Ricalocation not on record | 62 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 50 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 49 |
| Altos de Pipe, VE | 45 |
| Masindi, UG | 45 |
| Universidade Federal de Sergipe (UFS)location not on record | 43 |
| Université de Bordeauxlocation not on record | 43 |
| Salvador, BR | 41 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 39 |
| Miami, US | 39 |
| St. Augustine, TT | 37 |
| Universidade Federal do Maranhãolocation not on record | 36 |
| Departamento de Sistematica e Ecologialocation not on record | 33 |
| UFESlocation not on record | 33 |
| UFPElocation not on record | 31 |
| Chaguaramas, TT | 30 |
| Federal University of Espírito Santolocation not on record | 30 |
| Ann Arbor, US | 29 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 29 |
| Ciudad de México, MX | 26 |
| Porto Alegre, BR | 23 |
| MeiseBGlocation not on record | 22 |
| Mérida, MX | 19 |
| JBRJlocation not on record | 19 |
| UFBAlocation not on record | 19 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 19 |
| UFERSAlocation not on record | 18 |
| Austin, US | 18 |
| Jena Microbial Resource Collectionlocation not on record | 18 |
| Mexico City, MX | 18 |
| UnBlocation not on record | 18 |
| Universidade Federale do Rio Grande do Sullocation not on record | 17 |
| UNIVASFlocation not on record | 17 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 15 |
| UFSClocation not on record | 14 |
| San Francisco de Campeche, MX | 14 |
| WAGlocation not on record | 13 |
| LSF/FSA/UAClocation not on record | 13 |
| Xiamen, CN | 13 |
| Universidade Federal de Santa Catarinalocation not on record | 12 |
| Blumenau, BR | 12 |
| Museu Paraense Emílio Goeldilocation not on record | 12 |
| IECOSlocation not on record | 12 |
| Antiguo Cuscatlán, SV | 11 |
| Laboratorio de Ictiologialocation not on record | 11 |
| Universidad de Nariño (UdeNar)location not on record | 11 |
| Universidad Nacional de Colombia (UNAL)location not on record | 10 |
| Paris, FR | 10 |
| Riverside, US | 10 |
| Fortaleza, BR | 10 |
| UEMAlocation not on record | 9 |
| Tapachula, MX | 9 |
| CEPLAClocation not on record | 9 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 9 |
| Universidade Federal do Vale do São Franciscolocation not on record | 9 |
| UNICAMPlocation not on record | 8 |
| HNBlocation not on record | 8 |
| Mérida, MX | 7 |
| Bloomington, US | 7 |
| San José, CR | 7 |
| GB | 7 |
| IPA/SPlocation not on record | 7 |
| León, NI | 6 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 6 |
| Aarhus, DK | 6 |
| Chicago, US | 6 |
| South Kensington, GB | 5 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 5 |
| San Diego, US | 5 |
| Feira de Santana, BR | 5 |
| UFRPElocation not on record | 5 |
| LBVlocation not on record | 5 |
| Valdosta State Universitylocation not on record | 5 |
| Universidade Federal do Espírito Santolocation not on record | 5 |
| QCNElocation not on record | 5 |
| Berlin, DE | 5 |
| Plocation not on record | 5 |
| Museum of Zoologylocation not on record | 5 |
| UFMSlocation not on record | 5 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 5 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 5 |
| Conservatoire Botanique National de Mascarinlocation not on record | 4 |
| Brasília, BR | 4 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 4 |
| Herbier National du Gabonlocation not on record | 4 |
| Austin, US | 4 |
| San Angelo, US | 4 |
| DanBIFlocation not on record | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| Guasave, MX | 4 |
| ASUlocation not on record | 3 |
| Montréal, CA | 3 |
| VENlocation not on record | 3 |
| Bangkok, TH | 3 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 3 |
| Chongqing Museumlocation not on record | 3 |
| UEPAlocation not on record | 3 |
| UFSJlocation not on record | 3 |
| Area de Conservacion Guanacastelocation not on record | 3 |
| USP-IBlocation not on record | 3 |
| Corrientes, AR | 2 |
| Cascavel, BR | 2 |
| MEXUlocation not on record | 2 |
| Culiacán, MX | 2 |
| Burlington, US | 2 |
| Elocation not on record | 2 |
| GENTlocation not on record | 2 |
| Cenargenlocation not on record | 2 |
| Hermosillo, MX | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| URCAlocation not on record | 2 |
| La Paz, BO | 2 |
| Fort Worth, US | 2 |
| Edinburgh, GB | 2 |
| Universidade de São Paulolocation not on record | 2 |
| Sangmiung Universitylocation not on record | 2 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 2 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 2 |
| CPATSAlocation not on record | 2 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 2 |
| Montpellier, FR | 2 |
| Dekalb, US | 2 |
| Lubbock, US | 2 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 2 |
| Chapingo, MX | 2 |
| Davis, US | 2 |
| Mississippi State, US | 2 |
| Yaoundé, CM | 2 |
| Millersville, US | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| BMlocation not on record | 2 |
| Mazatlán, MX | 2 |
| UFRRJlocation not on record | 2 |
| Tlalnepantla, MX | 2 |
| Seropédica, BR | 2 |
| Brasília, BR | 2 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 2 |
| Uppsala, SE | 1 |
| Honolulu, US | 1 |
| US | 1 |
| Quito, EC | 1 |
| UCAMlocation not on record | 1 |
| Ciudad de México, MX | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Université du Lomélocation not on record | 1 |
| UFPRlocation not on record | 1 |
| UERJlocation not on record | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| UFMGlocation not on record | 1 |
| San Isidro, AR | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Managua, NI | 1 |
| POZGlocation not on record | 1 |
| Jackson, US | 1 |
| Auckland, NZ | 1 |
| Université National du Béninlocation not on record | 1 |
| Juriquilla, MX | 1 |
| Universidad Nacional Agrarialocation not on record | 1 |
| Toronto, CA | 1 |
| Cambridge, US | 1 |
| Santa Teresa, BR | 1 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 1 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| UNESP-RClocation not on record | 1 |
| UNIVILLElocation not on record | 1 |
| Calabar, NG | 1 |
| LDlocation not on record | 1 |
| Frankfurt am Main | 1 |
| University of Oxfordlocation not on record | 1 |
| Pullman, US | 1 |
| Maringá, BR | 1 |
| Salamanca, ES | 1 |
| Cruz das Almas, BR | 1 |
| Columbia, US | 1 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 1 |
| Zürich, CH | 1 |
| Flagstaff, US | 1 |
| BRLUlocation not on record | 1 |
| Ilhéus, BR | 1 |
| Zapopan, MX | 1 |
| Chapel Hill, US | 1 |
| GAlocation not on record | 1 |
| EL PASO, US | 1 |
| Mexico City, MX | 1 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 1 |
| MSB-2797location not on record | 1 |
| Pretoria, ZA | 1 |
| Guatemala City, GT | 1 |
| Clocation not on record | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| INMAlocation not on record | 1 |
| Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record | 1 |
| Eastern Illinois Universitylocation not on record | 1 |
| Campo Mourão, BR | 1 |
| VALElocation not on record | 1 |
| MAlocation not on record | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| Olocation not on record | 1 |
| La Paz, MX | 1 |
| Beijing, CN | 1 |
| Stockholm, SE | 1 |
| HEMlocation not on record | 1 |
| Moscow State Universitylocation not on record | 1 |
213 institutions · 2 648 of 2 798 vouchered records shown · 150 without an institution code
09Environmental DNA4 detections
Where the DNA of Cyperus ligularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found4
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 4 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median23.1 °C 23.1–23.1
Seasonal swing summer↔winter2.30 °C
Max temp (day)25.5 °C
Min temp (night)21.0 °C
Precipitation273 mm/mo
Air humidity73.2 %
Moisture balance158 mm/mo
Vapour deficit756 Pa
Wind speed2.10 m/s
Cloud cover21.7 %
CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.