Cyperus lecontei

Torr. ex Steud. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Cyperus

At a glance

Occurrence records469

Data sources9

Biological traits10

DNA specimens3

eDNA detections1

Sources9 archives

Databases and archives Cyperus lecontei's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility467 records↗

OBISOcean Biodiversity Information System2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF · OBIS469 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Cyperus lecontei, commonly known as Le Conte's flatsedge, is a species of sedge that is native to south eastern parts of the United States.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyperus lecontei has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences8

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF150562.1 ↗593 bp

ACGT

TTGTTGCCTTCAAACACGACCGGCGAACACGTAACGTTAAGCTACCGGGGAGGAGCTTCCTCTCTGGCCCCACCGGCCCCGACCCCTTGG …

Cyperus lecontei voucher FLAS:Abbott 23732 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL3★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type469 records

Wild obs. + sensor218

Museum / vouchered251

Range

Area of Occupancy AOO1 252 km²

Depth

0–200 m sunlit2

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1 m · max 1 m · 2 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 121≤1 km 23≤10 km 3>10 km 18

165 georeferenced · 53 without coordinates

Open the mapobservation + sensor218

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 10≤1 km 8≤10 km 24>10 km 18

60 georeferenced · 191 without coordinates

Open the institutions mapphysical evidence251

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jena Microbial Resource Collectionlocation not on record	51
Tampa, US	42
Mississippi State, US	16
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	15
Miami, US	15
US	13
Chapel Hill, US	11
Tuscaloosa, US	10
Bangkok, TH	9
Jackson, US	8
Tall Timbers Research Stationlocation not on record	6
San Angelo, US	5
Saint Louis, US	5
University of Stellenboschlocation not on record	5
Bloomington, US	5
Valdosta State Universitylocation not on record	4
Ann Arbor, US	3
Chongqing Museumlocation not on record	3
Flagstaff, US	2
Bronx, US	2
Florida Museum of Natural Historylocation not on record	2
Columbia, US	2
Auckland, NZ	2
GAlocation not on record	1
Tempe, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	1
Little Rock, US	1
Phoenix, US	1
McWane Science Centerlocation not on record	1
Fort Worth, US	1

31 institutions · 244 of 251 vouchered records shown · 7 without an institution code

09Environmental DNA1 detections

Where the DNA of Cyperus lecontei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)