Cyperus lacustris

Schrad. ex Nees · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Cyperus

At a glance

Occurrence records105

Data sources2

Biological traits12

DNA specimens0

eDNA detections0

Sources2 archives

Databases and archives Cyperus lacustris's data was compiled from.

GBIFGlobal Biodiversity Information Facility105 records↗

NCBIUS National Library of Medicinesequences↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources12 traits

Occurrence & distributionGBIF105 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formperennial or rhizomatous geophyte

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max240 m

Elevation min170 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTFloresta de Igapó, Floresta de Várzea

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyperus lacustris has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV662265.1 ↗690 bpBrazil · 2012

ACGT

GTCCACCTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTTGCCTTC …

Cyperus lacustris voucher Martinelli 17375 (RB) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type105 records

Wild obs. + sensor5

Museum / vouchered100

Origin

Native10

Range

Area of Occupancy AOO344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 2 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 100 records without

Open the institutions mapphysical evidence100

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	37
University of Stellenboschlocation not on record	29
Bronx, US	7
UFPElocation not on record	6
JBRJlocation not on record	4
Université de Bordeauxlocation not on record	2
Cuiabá, BR	2
Aarhus, DK	1
IPA/SPlocation not on record	1
La Paz, BO	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
UFPRlocation not on record	1

12 institutions · 92 of 100 vouchered records shown · 8 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)