Cyperus intricatus — The Life Data

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Cyperus

At a glance

Occurrence records2

Data sources3

Biological traits13

DNA specimens0

eDNA detections0

Sources3 archives

Databases and archives Cyperus intricatus's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF2 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifeform raunkiaer detailedgeophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 800 m

Elevation min1 300 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTCampo de Altitude, Campo Limpo, Floresta Ciliar ou Galeria, Floresta Ombrófila Mista

Woodinessnon-woody

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyperus intricatus has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV662203.1 ↗559 bpBrazil · 2018

ACGT

GGCCATATGGTCGGGTGCCGGAATACGGCGCGGAATGTCGCCAAGGAACACTGATCTGCCTATGCGGACGGCATTATGCCGGTGCTGCTA …

Cyperus intricatus voucher Pereira-Silva, L. 325 (FLOR) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type2 records

Museum / vouchered2

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	1
Austin, US	1

2 institutions · 2 of 2 vouchered records shown