Cyperus haspan
speciesAt a glance
Occurrence records7 320
Data sources16
Biological traits115
DNA specimens15
eDNA detections7
Sources16 archives
Databases and archives Cyperus haspan's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility7 291 records↗
OBISOcean Biodiversity Information System29 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics15 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources115 traits
Chemical compositionLOTUS · NPASS47 compounds
Occurrence & distributionGBIF · OBIS7 320 records
Environmental DNA1 datasets · 2 countries7 detections
DNA & barcodingBOLD · NCBI15 specimens
Genome at a glanceCCDB · GIFT · GoaT391 Mbp
01Narrative
De dwergpapyrus is een cypergras dat op een verkleinde versie van de echte papyrus lijkt. De plant heeft sterke halmen tot ongeveer een meter hoog, eindigend in een parasol van pluimen die eerst geelgroen zijn maar later een rijke bronskleur krijgen. De plant kan zowel eenjarig als blijvend zijn. De blijvende vorm heeft rood-paarse horizontale wortelstokken, waardoor hij zich ook kan voortplanten. De voortplanting kan ook door zaad geschieden; de zaden zijn omgekeerd eivormig, driezijdig en ongeveer 0,5 mm lang, romig geel en bobbelig. De plant heeft een groot verspreidingsgebied in de hele tropen en subtropen van de wereld, zowel in de Amerika's als in Afrika, Azië en Australië.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsUSDATRY
Size & morphology15
Fruit length0.6 mm
Fruit length max0.5 mm
Fruit width0.4 mm
Leaf length max100 mm
Leaf length min20 mm
Leaf width3.5 mm
Leaf width max5 mm
Leaf width min2 mm
Plant height0.75 m
⚠ sources differ — GIFT: 0.75 m · AusTraits: 0.4 m · USDA: 0.975 m · TRY: 0.975 m
Plant height max1 m
Plant height min0 m
Seed length0.4 mm
Seed mass0.063 mg
⚠ sources differ — TRY: 0.063 mg · AusTraits: 0.051 mg · GIFT: 0.065 mg
Seed mass max0.12 mg
Seed mass min0.02 mg
Life cycle & reproduction30
After harvest regrowth rateSlow
Bloom periodLate Spring
Coppice potentialNo
Dehiscenceindehiscent
Flower colourbrown
Flower conspicuousNo
Flowering timeyynnnnnnyyyy
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formannual or perennial
Life spanperennial
⚠ sources differ — TRY: Perennial · AusTraits: annual perennial · GIFT: perennial
Lifespan categoryLong
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedNo
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formtherophyte
Resprout abilityNo
Resprouting capacityfire_killed
Seed spread rateSlow
Seedling vigorMedium
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment30
Active growth periodSpring
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 551 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourwhite
Fruit fleshinessdry
Fruit typenut
⚠ sources differ — AusTraits: nut · GIFT: achene
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb
Growth form USDABunch
Habitat GIFTÁrea Antrópica, Vegetação Aquática
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionNo
Low growing grassNo
Root depth min16 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry20
Anaerobic toleranceMedium
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantYes
Fire toleranceMedium
Frost free days min230 days
Moisture useMedium
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min35 in
Salinity toleranceHigh
Shade toleranceHigh
Soil pH max7.5 pH
Soil pH min4.5 pH
Temperature min7 °F
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable graze animalMedium
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits6
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousYes
Fruit seed persistenceYes
Planting density max4 800 per acre
Planting density min3 500 per acre
03Chemical composition47 compounds
Compounds documented for Cyperus haspan across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Germacrane sesquiterpenoids9
Guaiane sesquiterpenoids8
Eudesmane sesquiterpenoids4
Noreudesmane sesquiterpenoids4
Flavones3
Documented compounds47 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-cis-Verbenol | present | NPASS | |
| (-)-Cyperene | present | NPASS | |
| (1R,3S,5R,6R)-7,7-dimethyl-2-methylidenebicyclo[3.1.1]heptane-3,6-diol | present | NPASS | |
| (1R,5R)-5-hydroxy-2,2,4-trimethylcyclohex-3-ene-1-carbaldehyde | present | NPASS | |
| (1R,5R,7R)-7-hydroxy-6,6-dimethyl-2-methylidenebicyclo[3.1.1]heptan-3-one | present | NPASS | |
| (1S,4S,5R,7S,8Z,11S)-4-hydroxy-4,9-dimethyl-14-methylidene-6,12-dioxatricyclo[9.3.0.05,7]tetradec-8-ene-10,13-dione | present | NPASS | |
| (3aS,6aS,9R,9aS,9bS)-6a,9-dihydroxy-9-methyl-3,6-dimethylidene-4,5,9a,9b-tetrahydro-3aH-azuleno[4,5-b]furan-2-one | present | NPASS | |
| (3aS,6aS,9S,9aS,9bS)-6a,9-dihydroxy-9-methyl-3,6-dimethylidene-4,5,9a,9b-tetrahydro-3aH-azuleno[4,5-b]furan-2-one | present | NPASS | |
| (3aS,6R,6aR,7S,8R,9S,9aS,9bR)-6,6a,7,8,9-pentahydroxy-6,9-dimethyl-3-methylidene-4,5,7,8,9a,9b-hexahydro-3aH-azuleno[4,5-b]furan-2-one | present | NPASS | |
| (3aS,6R,6aS,9aS,9bS)-6,9a-dihydroxy-6,9-dimethyl-3-methylidene-4,5,6a,9b-tetrahydro-3aH-azuleno[4,5-b]furan-2,7-dione | present | NPASS |
05DNA & barcoding15 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyperus haspan has left across the world's sequence archives.
At a glance
DNA specimens15
Marker genes4
GenBank sequences10
eDNA detections7
Countries5
The DNA barcodea real sequence read deposited for this species
GTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTGGGCGTTAG …
Cyperus haspan voucher MC50 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★ITS5★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GIFT · GoaT
The complete instruction manual Cyperus haspan carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size391 200 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Cyperus haspan0.39 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 26 n = 13
Ploidy2× diploid · measured
Chromosome records16–362n range26median26mode22records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 269×GoaT · Kew Plant DNA C-values Database · CCDB · cyper-only · CCDB · ipcn-api-dl +4
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · cyper-only — Nijalingappa, B. H. M., N. Nagaraj & D. H. Tejavathi1978
CCDB · cyper-only — Tejavathi, D. H. & B. H. M. Nijalingappa1990
CCDB · ipcn-api-dl — Tejavathi, D. H. & B. H. M. Nijalingappa. 1990. Cytological studies in some members of Cyperaceae. Cytologia 55: 363–372.
CCDB · ipcn-api-dl — Nijalingappa, B. H. M., N. NAGARAJ & D. H. TEJAVATHI. 1978. In IOPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · book-ipcn75-78 — Nijalingappa et al. 1978
CCDB · eflora
CCDB · kew — Greilhuber J. 1988. "Self-tanning" - a new and important source of stoichiometric error in cytophotometric determination of nuclear DNA content in plants. Plant Systematics and Evolution 158: 87-96.
GIFT · GIFT (floras)
2n 168×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · cyper-only — Sharma, A. K. & A. K. Sarkar19671968
CCDB · cyper-only — Sharma, A. K.1970
CCDB · cyper-only — Sanyal, B. & A. Sharma1972b
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn67-71 — SHARMA, A., & A.K. SARKAR (Editors). 1967-68. Chromosome number reports of plants in Annual Report, Cytogenetics Laboratory, Department of"li"otany, University of Calcutta. The Research Bulletin. 2: 38-Q8.
CCDB · book-ipcn75-78 — Sharma 1970
GIFT · GIFT (floras)
2n 304×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1
CCDB · cyper-only — Baquar, S. R.1978
CCDB · ipcn-api-dl
CCDB · book-ipcn75-78 — Baquar 1978
GIFT · GIFT (floras)
2n 361×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 136×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78
CCDB · cyper-only — Rath, S. P. & S. N. Patnaik1978a
CCDB · cyper-only — Rath, S. P. & S. N. Patnaik1978b
CCDB · cyper-only — Rath, S. P.1986
CCDB · ipcn-api-dl — Rath, S. P. & S. N. PATNAIK. 1978. Cytological studies in Cyperaceae. Proc. Indian Sci. Congr. Assoc. (III, C) 65: 107–108.
CCDB · ipcn-api-dl — Rath, S. P. & S. N. PATNAIK. 1978. Cytological studies in Cyperaceae with special reference to its taxonomy II. Cytologia 43: 643–653.
CCDB · book-ipcn75-78 — Rath & Patnaik 1978
n 185×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · cyper-only — Mehra, P. N. & S. K. Sachdeva1971
CCDB · cyper-only — Mehra, P. N. & S. K. Sachdeva1975b
CCDB · ipcn-api-dl — Mehra, P. N. & S. K. Sachdeva. 1975. Cytology of some west Himalayan Cyperaceae. Cytologia 40: 497–515.
CCDB · book-ipcn67-71 — MEHRA, P.N . & S.K. SACHDEVA. 1971. In IOPB chromosome reports XXXIII. Taxon 20: 609-614.
CCDB · book-ipcn75-78 — Mehra & Sachdeva 1975
n 83×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78
CCDB · cyper-only — Sarkar, A. K., M. Chakraborty, N. C. Saha, S. K. Das & D. Hazra1978
CCDB · ipcn-api-dl — Sarkar, A. K., M. CHAKRABORTY, N. C. SAHA, S. K. DAS & D. HAZRA. 1978b. In IOPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · book-ipcn75-78 — Sarkar et al. 1978b
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
08Occurrence & distribution
Record type7 320 records
Wild obs. + sensor1 325
Museum / vouchered5 767
Cultivated / captive1
Other227
Origin
Native979
Range
Area of Occupancy AOO17 056 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy83% within 1 km
≤100 m 526≤1 km 68≤10 km 50>10 km 73
717 georeferenced · 608 without coordinates
Open the mapobservation + sensor1 325
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy49% within 1 km
≤100 m 192≤1 km 109≤10 km 198>10 km 112
611 georeferenced · 5 156 without coordinates
Open the institutions mapphysical evidence5 767
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 1 records without
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions150 of 334 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Bronx, US | 439 |
| Saint Louis, US | 383 |
| Université de Bordeauxlocation not on record | 283 |
| Kew, GB | 215 |
| MeiseBGlocation not on record | 141 |
| Porto Alegre, BR | 126 |
| Tampa, US | 121 |
| UnBlocation not on record | 117 |
| University of Stellenboschlocation not on record | 95 |
| Chiba, JP | 95 |
| Masindi, UG | 94 |
| Taipei, TW | 78 |
| Forest Herbarium Ibadan (FHI)location not on record | 75 |
| Sanda, JP | 74 |
| UFPElocation not on record | 73 |
| Guangzhou, CN | 68 |
| UFMSlocation not on record | 66 |
| Jena Microbial Resource Collectionlocation not on record | 65 |
| Altos de Pipe, VE | 62 |
| Jackson, US | 62 |
| Miami, US | 58 |
| Brasília, BR | 57 |
| Durango, MX | 57 |
| Mexico City, MX | 54 |
| Valdosta State Universitylocation not on record | 53 |
| Akita Prefectural Museumlocation not on record | 50 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 49 |
| National Biodiversity Institute, Costa Ricalocation not on record | 47 |
| Salvador, BR | 45 |
| Austin, US | 45 |
| Paris, FR | 45 |
| Laboratorio de Ictiologialocation not on record | 43 |
| US | 42 |
| Museu Paraense Emílio Goeldilocation not on record | 41 |
| Kunming, CN | 41 |
| BAYLUlocation not on record | 38 |
| Fort Worth, US | 34 |
| UFSClocation not on record | 34 |
| JBRJlocation not on record | 33 |
| UNICAMPlocation not on record | 32 |
| Bangkok, TH | 31 |
| USP-IBlocation not on record | 30 |
| Taipei, TW | 29 |
| Universidade Federal de Santa Catarinalocation not on record | 29 |
| Nagatoro-machi, Chichibu-gun, JP | 26 |
| UFBAlocation not on record | 26 |
| UFESlocation not on record | 25 |
| Brasília, BR | 25 |
| Cenargenlocation not on record | 25 |
| National Institute of Biological Resourceslocation not on record | 24 |
| IPA/SPlocation not on record | 24 |
| Blumenau, BR | 24 |
| WAGlocation not on record | 24 |
| Bando, JP | 24 |
| Federal University of Espírito Santolocation not on record | 24 |
| Plocation not on record | 23 |
| Universidade Federal de Goiáslocation not on record | 23 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 23 |
| CEPLAClocation not on record | 23 |
| Yaoundé, CM | 23 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 22 |
| Guilin, CN | 22 |
| Paleontological Collectionlocation not on record | 21 |
| Feira de Santana, BR | 21 |
| Universidade Federale do Rio Grande do Sullocation not on record | 21 |
| Columbia, US | 21 |
| Cuiabá, BR | 20 |
| Santa Cruz de la Sierra, BO | 20 |
| MAlocation not on record | 20 |
| CNF-UFHBlocation not on record | 19 |
| UFMGlocation not on record | 19 |
| TAIElocation not on record | 19 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 19 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 19 |
| Tuscaloosa, US | 19 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 18 |
| Armidale, AU | 17 |
| Nagasaki University - Fisherieslocation not on record | 17 |
| Chaguaramas, TT | 17 |
| Xiamen, CN | 16 |
| Mississippi State, US | 15 |
| Guangzhou, CN | 15 |
| Universidade Federal de Sergipe (UFS)location not on record | 15 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 15 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 15 |
| St. Augustine, TT | 14 |
| GAlocation not on record | 14 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 14 |
| Honolulu, US | 14 |
| San Francisco de Campeche, MX | 14 |
| Chongqing Museumlocation not on record | 13 |
| Frankfurt am Main | 13 |
| Taipei, TW | 13 |
| Beijing, CN | 13 |
| Ilhéus, BR | 12 |
| Smithfield, AU | 12 |
| Adelaide, AU | 12 |
| Mérida, MX | 12 |
| Universidad Nacional de Colombia (UNAL)location not on record | 12 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 11 |
| Ann Arbor, US | 11 |
| Departamento de Sistematica e Ecologialocation not on record | 11 |
| Nanjing, CN | 11 |
| Ivano-Frankivsk, UA | 10 |
| Bloomington, US | 10 |
| UEMlocation not on record | 10 |
| Kensington, AU | 10 |
| BISHlocation not on record | 10 |
| CJBGlocation not on record | 9 |
| IECOSlocation not on record | 9 |
| Mount Annan, AU | 9 |
| University of Southern Mississippilocation not on record | 9 |
| South Kensington, GB | 9 |
| KURAlocation not on record | 9 |
| Kochi, JP | 9 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 9 |
| PUC-RSlocation not on record | 9 |
| Changsha, CN | 8 |
| Bogotá, D.C., CO | 8 |
| UNESP-RClocation not on record | 8 |
| León, NI | 8 |
| Berlin, DE | 8 |
| UEMAlocation not on record | 8 |
| Chapel Hill, US | 8 |
| AUAlocation not on record | 8 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 8 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 8 |
| LBVlocation not on record | 8 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 8 |
| Hangzhou, CN | 8 |
| Chicago, US | 7 |
| Chengdu, CN | 7 |
| Kagoshima, JP | 7 |
| UFPRlocation not on record | 7 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 7 |
| Brussels, BE | 7 |
| INMAlocation not on record | 7 |
| Wuhan, CN | 7 |
| UEPAlocation not on record | 7 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 7 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 6 |
| Université National du Béninlocation not on record | 6 |
| Tall Timbers Research Stationlocation not on record | 6 |
| Santa Teresa, BR | 6 |
| Flagstaff, US | 6 |
| Wlocation not on record | 6 |
| UNITINSlocation not on record | 6 |
| VENlocation not on record | 6 |
| San José, CR | 6 |
| Université de Strasbourglocation not on record | 6 |
| Knoxville, US | 6 |
| Montréal, CA | 6 |
| Universidad Nacional de Asunciónlocation not on record | 5 |
| Zhejiang Universitylocation not on record | 5 |
| BRLUlocation not on record | 5 |
| Philadelphia, US | 5 |
| Norfolk, US | 5 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 5 |
| Edinburgh, GB | 5 |
| UFRPElocation not on record | 5 |
| UFERSAlocation not on record | 5 |
| IPHAMETRAlocation not on record | 5 |
| Pretoria, ZA | 5 |
| Universidade Federal do Maranhãolocation not on record | 5 |
| Museum of Zoologylocation not on record | 5 |
| San Angelo, US | 5 |
| Ural Federal University "B. N. Yeltsin"location not on record | 5 |
| Corrientes, AR | 5 |
| Williamsburg, US | 5 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 5 |
| La Paz, MX | 5 |
| Lake Charles, US | 5 |
| Cibinong Science Center, Herbarium Bogorienselocation not on record | 4 |
| Antiguo Cuscatlán, SV | 4 |
| Herbier National du Gabonlocation not on record | 4 |
| LSF/FSA/UAClocation not on record | 4 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 4 |
| Palmerston, AU | 4 |
| Universidad Nacional Agrarialocation not on record | 4 |
| UTFPR-CPlocation not on record | 4 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 4 |
| Zhengzhou, CN | 4 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 4 |
| Londrina, BR | 4 |
| Awka, NG | 4 |
| UNESP, Campus São José Rio Prêtolocation not on record | 4 |
| Universidad de los Andes (UniAndes)location not on record | 4 |
| Istituto Agrario Castelnuovolocation not on record | 4 |
| Fortaleza, BR | 4 |
| Seychelles National Herbariumlocation not on record | 3 |
| Criciúma, BR | 3 |
| Foz do Iguaçu, BR | 3 |
| Teresina, BR | 3 |
| Uppsala, SE | 3 |
| Burlington, US | 3 |
| KOMlocation not on record | 3 |
| Clocation not on record | 3 |
| Campo Mourão, BR | 3 |
| Shanghai, CN | 3 |
| GB | 3 |
| Elocation not on record | 3 |
| Durham, US | 3 |
| UNESClocation not on record | 3 |
| Little Rock, US | 3 |
| Tomioka, JP | 3 |
| Universidad Pablo de Olavidelocation not on record | 3 |
| La Paz, BO | 3 |
| Clemson, US | 3 |
| Olocation not on record | 3 |
| Auckland, NZ | 3 |
| Moscow State Universitylocation not on record | 3 |
| Durham, US | 3 |
| Canberra, AU | 3 |
| UFSJlocation not on record | 2 |
| HACAMlocation not on record | 2 |
| UNESP-FCAlocation not on record | 2 |
| UDESC-CAVlocation not on record | 2 |
| Xian, CN | 2 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 2 |
| San Isidro, AR | 2 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 2 |
| Sangmiung Universitylocation not on record | 2 |
| Instituto de Investigação Científica Tropicallocation not on record | 2 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 2 |
| ASUlocation not on record | 2 |
| Aarhus, DK | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| Cambridge, US | 2 |
| Wuhan, CN | 2 |
| Seoul, KR | 2 |
| Texas Lutheran Universitylocation not on record | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Uberlândia, BR | 2 |
| Sendai, JP | 2 |
| UNEMATlocation not on record | 2 |
| Claremont, US | 2 |
| Guasave, MX | 2 |
| Glocation not on record | 2 |
| Universidade Federal do Vale do São Franciscolocation not on record | 2 |
| Xining, CN | 2 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 2 |
| LSFlocation not on record | 2 |
| Calabar, NG | 2 |
| Madison, US | 2 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 2 |
| Santarém, BR | 2 |
| South China Normal Universitylocation not on record | 2 |
| National Museums of Kenyalocation not on record | 2 |
| FPMZBlocation not on record | 2 |
| Ciudad de México, MX | 2 |
| Maringá, BR | 2 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 2 |
| IAPlocation not on record | 1 |
| Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record | 1 |
| Christchurch, NZ | 1 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 1 |
| National Natural History Collectionslocation not on record | 1 |
| Pullman, US | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| UFOPlocation not on record | 1 |
| UNESP-FCAVlocation not on record | 1 |
| Zürich, CH | 1 |
| Logan, US | 1 |
| EL PASO, US | 1 |
| Badajoz, ES | 1 |
| Peking Universitylocation not on record | 1 |
| Mount Pleasant, US | 1 |
| UTFPR-DVlocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Moscow, US | 1 |
| Coimbra, PT | 1 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| Mérida, MX | 1 |
| Juriquilla, MX | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| ex-Centro Nacional de Investigação Cientifica (CNIC)location not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| POZGlocation not on record | 1 |
| Tapachula, MX | 1 |
| Phoenix, US | 1 |
| UTPLlocation not on record | 1 |
| QCNElocation not on record | 1 |
| Universidade do Estado de Santa Catarinalocation not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Leiden University Medical Centerlocation not on record | 1 |
| San Diego, US | 1 |
| Cruz das Almas, BR | 1 |
| Baroda, IN | 1 |
| Eastern Illinois Universitylocation not on record | 1 |
| Addis Ababa, ET | 1 |
| Chadron, US | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| Forestry Research Institute of Nigerialocation not on record | 1 |
| Botanic Gardenlocation not on record | 1 |
| LISClocation not on record | 1 |
| Hobart, AU | 1 |
| EAlocation not on record | 1 |
| PHlocation not on record | 1 |
| Njala Universitylocation not on record | 1 |
| Pennsylvania Department of Agriculturelocation not on record | 1 |
| Goucher Collegelocation not on record | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| Appalachian State Universitylocation not on record | 1 |
| Helsinki, FI | 1 |
| GENTlocation not on record | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| LDlocation not on record | 1 |
| Stockholm, SE | 1 |
| BMlocation not on record | 1 |
| Denver, US | 1 |
| UFSMlocation not on record | 1 |
| Riverside, US | 1 |
| Loja, EC | 1 |
| CASlocation not on record | 1 |
| HUAlocation not on record | 1 |
| UNIVASFlocation not on record | 1 |
| FUVATESlocation not on record | 1 |
| Wuzhou, CN | 1 |
| UEGlocation not on record | 1 |
| Madrid, ES | 1 |
| VALElocation not on record | 1 |
| Dresden, DE | 1 |
| UESBlocation not on record | 1 |
| UTFPR-SLlocation not on record | 1 |
| UFVJMlocation not on record | 1 |
| Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record | 1 |
| Dehra Dun, IN | 1 |
| OTSlocation not on record | 1 |
| Universidade Estadual Paulistalocation not on record | 1 |
| HNBlocation not on record | 1 |
| Llocation not on record | 1 |
334 institutions · 5 600 of 5 767 vouchered records shown · 165 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA7 detections
Where the DNA of Cyperus haspan was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found7
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 7 detections have coordinates
Open the map2 countries0
Edges of irrigation ditchesGrassland
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.0 °C 12.6–26.0
Seasonal swing summer↔winter21.6 °C
Max temp (day)21.2 °C 16.4–28.4
Min temp (night)13.4 °C 7.40–22.0
Precipitation187 mm/mo 112–406
Air humidity63.6 % 58.0–70.5
Moisture balance65.3 mm/mo 21.7–280
Vapour deficit759 Pa 690–1,023
Wind speed2.60 m/s 1.80–2.90
Cloud cover45.6 % 41.1–52.5
CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.