Cyperus gracilis

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Cyperus

At a glance

Occurrence records11 610

Data sources9

Biological traits36

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Cyperus gracilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility11 610 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources36 traits

Chemical compositionLOTUS7 compounds

Occurrence & distributionGBIF11 610 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

السّعد المستدير نوع نباتي يتبع جنس السعد من الفصيلة السعدية. موطنه الأصلي أستراليا.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology12

Fruit length1.2 mm

Fruit length max1 mm

Fruit width0.8 mm

Leaf length max0.5 mm

Leaf width1 mm

Leaf width max1 mm

Leaf width min0.5 mm

Plant height1 m

Plant height max0.35 m

Plant height min0.1 m

Seed length0.8 mm

Seed mass0.332 mg

Life cycle & reproduction9

Dehiscenceindehiscent

Dispersal typeself

Flowering timeyynnnnnnyyyy

Life formannual or perennial

Life spanperennial

Lifeform raunkiaer detailedhemicryptophyte

Pollination syndromewind

Resprouting capacityresprouts

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

⚠ sources differ — AusTraits: nut · GIFT: achene

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: tussock

Habitat GIFTdry forest, Savanna, dense secondary shrub and ruderal vegetation

Leaf compoundnesssimple

Leaf shapefiliform

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition7 compounds

Compounds documented for Cyperus gracilis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Noreudesmane sesquiterpenoids3

Aromatic polyketides with side chains1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
2-Acetyl-4,8-dihydro-5-methylbenzo[1,2-b:5,4-b']difuran-4,8-dione	present	LOTUS
2-Prop-1-en-2-ylfuro[3,2-f][1]benzofuran-4,8-dione	present	LOTUS
3-[(Z)-heptadec-8-enyl]-2-hydroxy-5-methoxycyclohexa-2,5-diene-1,4-dione	present	LOTUS
5-Methyl-2-prop-1-en-2-yl-2,3,5,6-tetrahydrofuro[3,2-f][1]benzofuran-4,8-dione	present	LOTUS
BENZO(1,2-b:5,4-b')DIFURAN-4,8-DIONE, 2,3-DIHYDRO-2-ISOPROPENYL-5-METHYL-, (-)-	present	LOTUS
Benzo[1,2-b:5,4-b']difuran-4,8-dione, 2-[1-(hydroxymethyl)vinyl]-5-methyl-	present	LOTUS
Cyperaquinone	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyperus gracilis has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496824.1 ↗566 bpAustralia · 2013

ACGT

CTAAAGCAAGTGTTGGCTTTAAAGCAGGGGTAAAAGATTACAAACTTACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCT …

Cyperus gracilis isolate XB11 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type11 610 records

Wild obs. + sensor9 968

Museum / vouchered839

Cultivated / captive3

Other800

Origin

Native137

Introduced2

Range

Area of Occupancy AOO21 764 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 9 463≤1 km 355≤10 km 67>10 km 24

9 909 georeferenced · 59 without coordinates

Open the mapobservation + sensor9 968

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 306≤1 km 44≤10 km 236>10 km 102

688 georeferenced · 151 without coordinates

Open the institutions mapphysical evidence839

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 2 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	318
Mount Annan, AU	139
NSW Dept of Planning, Industry and Environmentlocation not on record	90
Canberra, AU	60
Armidale, AU	46
Museo Entomologico de Leonlocation not on record	32
Paris, FR	20
Kew, GB	15
Smithfield, AU	14
John T. Waterhouse Herbariumlocation not on record	13
Université de Strasbourglocation not on record	10
Honolulu, US	8
James Cook Townsvillelocation not on record	8
Christchurch, NZ	8
BISHlocation not on record	7
NSW Office of Environment and Heritagelocation not on record	5
Wollongong, AU	5
Auckland, NZ	5
Palmerston, AU	4
Batemans Bay, AU	4
Adelaide, AU	3
UnBlocation not on record	2
University of Stellenboschlocation not on record	2
Canadian Department of Agriculturelocation not on record	2
Hobart, AU	2
Parkville, AU	2
South Kensington, GB	2
Tampa, US	1
Angwin, US	1
Zürich, CH	1
San Angelo, US	1
Riverside, US	1
Stockholm, SE	1

33 institutions · 832 of 839 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Cyperus gracilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cyperus gracilis

At a glance

Sources9 archives

Size & morphology12

Life cycle & reproduction9

Diet & foraging1

Habitat & environment11

Physiology & chemistry2

Other traits1

Compound class profile2 classes

Documented compounds7 total

At a glance

Record type11 610 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions23 of 33 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type11 610 records