Cyperus flavescens
speciesAt a glance
Occurrence records8 328
Data sources11
Biological traits126
DNA specimens13
eDNA detections21
Sources11 archives
Databases and archives Cyperus flavescens's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility8 328 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics13 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources126 traits
Occurrence & distributionGBIF8 328 records
Environmental DNA2 datasets · 4 countries21 detections
DNA & barcodingBOLD · NCBI13 specimens
Genome at a glanceCCDB2n = 50
01Narrative
Cyperus flavescens, le Souchet jaunâtre, est une espèce de plantes à fleurs de la famille des Cyperaceae, à répartition cosmopolite. C'est une herbacée annuelle cespiteuse, à fleurs en épis, poussant de préférence dans les lieux humides.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYAusTraitsWCVP
Size & morphology15
Fruit length1 mm
Fruit width0.7 mm
Leaf length max1 mm
Leaf mass4.36 mg
Leaf size142 mm²
Leaf width1.5 mm
Leaf width max1 mm
Plant height0.377 m
⚠ sources differ — GIFT: 0.377 m · LEDA: 0.143 m · USDA: 0.61 m · TRY: 0.165 m
Plant height generative0.085 m
Plant height max0.44 m
Plant height min0.03 m
Seed length1.22 mm
Seed mass0.093 mg
⚠ sources differ — TRY: 0.093 mg · AusTraits: 0.141 mg · LEDA: 0.166 mg · GIFT: 0.084 mg
Seed mass max0.07 mg
Seed mass min0.01 mg
Life cycle & reproduction37
After harvest regrowth rateSlow
Bloom periodLate Summer
Coppice potentialNo
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: zoochorous
Flower colourred
Flower conspicuousNo
Flowering endOct
Flowering startJul
Flowering timeyynnnnnnyyyy
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formannual
Life spanannual
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedNo
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number206
Seed spread rateSlow
Seedling vigorLow
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment30
Active growth periodSummer and Fall
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatesubtropical
Climberself-supporting
Elevation max2 820 m
Elevation mean1 700 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureFine
Fruit colourblack
Fruit typenut
⚠ sources differ — AusTraits: nut · GIFT: achene
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb
Growth form USDABunch
Habitat GIFTÁrea Antrópica, Campo Rupestre, Cerrado (lato sensu), Floresta Estacional Decidual, Manguezal, Restinga
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza type0.00014931
Root depth min8 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry21
Anaerobic toleranceMedium
C:N ratioMedium
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceLow
Frost free days min90 days
Leaf dry-matter content (LDMC)147 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC4
Precipitation max55 in
Precipitation min24 in
Salinity toleranceNone
Shade toleranceHigh
Soil pH max7 pH
Soil pH min5 pH
Specific leaf area (SLA)34.21 mm²/mg
Temperature min42 °F
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits8
Diaspore typeone-seeded generative dispersule
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceYes
Planting density max18 000 per acre
Planting density min11 000 per acre
Seeds per fruit101-1000
05DNA & barcoding13 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyperus flavescens has left across the world's sequence archives.
At a glance
DNA specimens13
Marker genes6
GenBank sequences10
eDNA detections21
Countries5
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTGGGCGTTAGAAGCCC …
Cyperus flavescens voucher CCDB-23327-H03 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL3★rbcLa★ITS4★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Cyperus flavescens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 50 n = 25
Chromosome records50–702n range50median50mode8records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 505×CCDB · slov-fl · CCDB · cyper-only · CCDB · ipcn-api-dl
CCDB · slov-fl — Murín A., 1992: Karyological study of the Slovak flora XXIV. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 39: 45-51.
CCDB · cyper-only — 330Queiros, M.1983
CCDB · cyper-only — Murin, A.1992
CCDB · ipcn-api-dl — Queiros, M. 1983a. Números cromossómicos para a Flora Portugesa, 64-85. Bol. Soc. Brot. 56: 79–98.
CCDB · ipcn-api-dl — Murín, A. 1992. Karyological study of the Slovak flora XXIV. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 39: 45–51.
2n 703×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78
CCDB · cyper-only — 330Sarkar, A. K., R. Mallick, N. Dutta & U. Chatterjee1977
CCDB · ipcn-api-dl
CCDB · book-ipcn75-78 — Sarkar et al. 1977b
n 491×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — RATH, S.P., J. MOHAPATRA, & S.N. PATNAIK. 1973. Cytotaxonomic studies in the genus Cyperus L. ( s .1.). Proc. Indian Sci. Congr. 'Assoc. 60: 314-316.
08Occurrence & distribution
Record type8 328 records
Wild obs. + sensor5 783
Museum / vouchered2 466
Other79
Origin
Native138
Introduced34
Range
Area of Occupancy AOO17 080 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy14% within 1 km
≤100 m 450≤1 km 192≤10 km 3 955>10 km 142
4 739 georeferenced · 1 044 without coordinates
Open the mapobservation + sensor5 783
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy41% within 1 km
≤100 m 169≤1 km 295≤10 km 599>10 km 66
1 129 georeferenced · 1 337 without coordinates
Open the institutions mapphysical evidence2 466
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions116 of 216 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Philadelphia, US | 125 |
| BIO-UNIPIlocation not on record | 125 |
| Jackson, US | 115 |
| Bronx, US | 83 |
| Kew, GB | 79 |
| Chongqing Museumlocation not on record | 65 |
| BRNUlocation not on record | 53 |
| Salzburg, AT | 53 |
| Bern, CH | 52 |
| University of Stellenboschlocation not on record | 47 |
| Moscow State Universitylocation not on record | 44 |
| Zürich, CH | 43 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 42 |
| Adam Mickiewicz University in Poznańlocation not on record | 42 |
| Lausanne, CH | 42 |
| MeiseBGlocation not on record | 41 |
| GJOlocation not on record | 38 |
| Zürich, CH | 35 |
| Uniwersytet Wrocławskilocation not on record | 34 |
| Bloomington, US | 31 |
| Dresden, DE | 30 |
| Saint Louis, US | 29 |
| Brisbane, AU | 29 |
| LDlocation not on record | 28 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 26 |
| Durango, MX | 25 |
| Mount Annan, AU | 24 |
| Tampa, US | 24 |
| Williamsburg, US | 24 |
| Ann Arbor, US | 23 |
| BFLlocation not on record | 23 |
| Fort Worth, US | 21 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 19 |
| Miami, US | 19 |
| Provincia di Livornolocation not on record | 19 |
| BDBClocation not on record | 19 |
| Bangkok, TH | 18 |
| College Park, US | 17 |
| Barcelona, ES | 17 |
| Valdosta State Universitylocation not on record | 17 |
| Jena Microbial Resource Collectionlocation not on record | 16 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 15 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 14 |
| Tuscaloosa, US | 14 |
| CJBGlocation not on record | 14 |
| Morgantown, US | 14 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 14 |
| Regensburgische Botanische Gesellschaftlocation not on record | 13 |
| Görlitz, DE | 13 |
| Salamanca, ES | 13 |
| BClocation not on record | 12 |
| KFGBlocation not on record | 12 |
| Chapel Hill, US | 12 |
| San Angelo, US | 11 |
| Austin, US | 11 |
| Lord Fairfax Community Collegelocation not on record | 10 |
| LfUlocation not on record | 10 |
| UnBlocation not on record | 10 |
| Armidale, AU | 10 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 9 |
| Knoxville, US | 9 |
| CEPLAClocation not on record | 9 |
| HNBlocation not on record | 9 |
| UFSClocation not on record | 8 |
| Badajoz, ES | 8 |
| Oskarshamn, SE | 8 |
| Berlin, DE | 8 |
| Columbia, US | 7 |
| Allentown, US | 7 |
| San Sebastián, ES | 7 |
| Mlocation not on record | 7 |
| Christchurch, NZ | 6 |
| Auckland, NZ | 6 |
| Vitoria, ES | 6 |
| Universidade Federal de Santa Catarinalocation not on record | 6 |
| Blumenau, BR | 6 |
| València, ES | 6 |
| Bourges, FR | 6 |
| Flagstaff, US | 6 |
| Porrentruy, CH | 6 |
| Little Rock, US | 6 |
| Millersville, US | 6 |
| Canberra, AU | 5 |
| University of Southern Mississippilocation not on record | 5 |
| Palmerston, AU | 5 |
| Tlalnepantla, MX | 5 |
| Guasave, MX | 5 |
| Canadian Department of Agriculturelocation not on record | 5 |
| Museo Entomologico de Leonlocation not on record | 5 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 5 |
| Richmond, US | 5 |
| University of Tennessee at Chattanoogalocation not on record | 4 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 4 |
| Sevilla, ES | 4 |
| Museum of the Rockieslocation not on record | 4 |
| Ciudad de México, MX | 4 |
| Wlocation not on record | 4 |
| Fayetteville, US | 4 |
| Tall Timbers Research Stationlocation not on record | 4 |
| Museo Achille Folettolocation not on record | 4 |
| US | 4 |
| Mississippi State, US | 4 |
| Porto Alegre, BR | 4 |
| GAlocation not on record | 4 |
| National Biodiversity Institute, Costa Ricalocation not on record | 4 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| Toluca, MX | 3 |
| Uppsala, SE | 3 |
| ZRC-SAZUlocation not on record | 3 |
| Denton, US | 3 |
| Wuzhou, CN | 3 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 3 |
| Frauenfeld, CH | 3 |
| Kostrzyca Forest Gene Banklocation not on record | 3 |
| Alicante, ES | 3 |
| New Brunswick, US | 3 |
| Pittsburg, US | 3 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 3 |
| ASUlocation not on record | 2 |
| Entomological Society of Latvialocation not on record | 2 |
| OTSlocation not on record | 2 |
| UFPElocation not on record | 2 |
| Cuiabá, BR | 2 |
| Clemson, US | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| Brasília, BR | 2 |
| St. Augustine, TT | 2 |
| Muséum Henri Lecoqlocation not on record | 2 |
| EL PASO, US | 2 |
| Chapingo, MX | 2 |
| BAYLUlocation not on record | 2 |
| H-Hohlalocation not on record | 2 |
| Mexico City, MX | 2 |
| Asheville, US | 2 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 2 |
| Cenargenlocation not on record | 2 |
| UGentlocation not on record | 2 |
| Fairfax, US | 2 |
| USP-IBlocation not on record | 2 |
| Philadelphia, US | 2 |
| Chicago, US | 2 |
| Altos de Pipe, VE | 2 |
| Claremont, US | 2 |
| Dekalb, US | 2 |
| MAlocation not on record | 2 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 2 |
| AUAlocation not on record | 2 |
| Riverside, US | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Tennessee Technological Universitylocation not on record | 2 |
| SZUlocation not on record | 2 |
| Montréal, CA | 2 |
| Dover, US | 2 |
| Laboratorio de Ictiologialocation not on record | 1 |
| South Kensington, GB | 1 |
| Londrina, BR | 1 |
| Foz do Iguaçu, BR | 1 |
| WTUlocation not on record | 1 |
| Arcata, US | 1 |
| Smithsonian Institutionlocation not on record | 1 |
| San Diego, US | 1 |
| Madrid, ES | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| León, NI | 1 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 1 |
| Logan, US | 1 |
| LSFlocation not on record | 1 |
| Rishon Le Zion, IL | 1 |
| Pullman, US | 1 |
| LBVlocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Aarhus, DK | 1 |
| H-Meierottlocation not on record | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| Frankfurt am Main | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| Herbier National du Gabonlocation not on record | 1 |
| NoColllocation not on record | 1 |
| Johnson City, US | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| Jaén, ES | 1 |
| Tilburg, NL | 1 |
| Vancouver, CA | 1 |
| LINUlocation not on record | 1 |
| Bratislava, SK | 1 |
| Glarus, CH | 1 |
| Durham, US | 1 |
| Brasília, BR | 1 |
| Monastir, TN | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| GZUlocation not on record | 1 |
| Chicago, US | 1 |
| BISHlocation not on record | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| Zacatecas, MX | 1 |
| Juriquilla, MX | 1 |
| Autlán de Navarro, MX | 1 |
| Due West, US | 1 |
| University of Hamburglocation not on record | 1 |
| ER Hellerlocation not on record | 1 |
| Córdoba, ES | 1 |
| ULBF-AGRlocation not on record | 1 |
| Banyoles, ES | 1 |
| UBT-Kaullocation not on record | 1 |
| Madison, US | 1 |
| Santa Barbara, US | 1 |
| Universität Erlangen-Nürnberglocation not on record | 1 |
| UNESP-RClocation not on record | 1 |
| Hobart, AU | 1 |
| Davis, US | 1 |
| IPA/SPlocation not on record | 1 |
| IAPlocation not on record | 1 |
216 institutions · 2 322 of 2 466 vouchered records shown · 142 without an institution code
09Environmental DNA21 detections
Where the DNA of Cyperus flavescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found21
Studies independent surveys2
Countries4
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 21 detections have coordinates
Open the map4 countries0
Growing in a strem,near Vernonia,Indigofera …
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.6 °C 15.4–18.0
Seasonal swing summer↔winter21.2 °C
Max temp (day)22.0 °C 20.5–22.0
Min temp (night)13.6 °C 10.6–13.6
Precipitation63.0 mm/mo 63.0–84.8
Air humidity59.9 % 57.7–59.9
Moisture balance-47.4 mm/mo -47.4–-23.2
Vapour deficit808 Pa 804–832
Wind speed3.70 m/s 3.30–4.70
Cloud cover32.5 % 32.5–43.1
CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.