Cyperus esculentus
speciesAt a glance
Occurrence records21 209
Data sources17
Biological traits135
DNA specimens39
eDNA detections23
Sources17 archives
Databases and archives Cyperus esculentus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility21 184 records↗
OBISOcean Biodiversity Information System25 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics39 specimens↗
NCBIUS National Library of Medicinesequences↗
foodatlascompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources135 traits
Chemical compositionFoodAtlas · LOTUS · NPASS41 compounds
Occurrence & distributionGBIF · OBIS21 209 records
Environmental DNA1 datasets · 6 countries23 detections
DNA & barcodingBOLD · NCBI39 specimens
Genome at a glanceCCDB · GIFT · GoaT587 Mbp
01Narrative
Le souchet comestible, souchet tubéreux ou souchet sucré, est une espèce de plantes à fleurs herbacées rhizomateuses vivaces de la famille des Cyperaceae. C'est une plante qui peut être considérée comme envahissante hors de ses aires d’origine.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYLEDAGIFTAusTraitsWCVPUSDA
Size & morphology18
Fruit length1.5 mm
Fruit length max1.8 mm
Fruit length min1.2 mm
Fruit width0.8 mm
Fruit width max1.2 mm
Fruit width min0.6 mm
Leaf length max50 mm
Leaf length min1 mm
Leaf width4.5 mm
⚠ sources differ — AusTraits: 4.5 mm · GIFT: 6 mm
Leaf width max10 mm
Leaf width min1 mm
Plant height0.555 m
⚠ sources differ — GIFT: 0.555 m · USDA: 0.213 m · TRY: 0.407 m
Plant height max1 m
Plant height min0.05 m
Seed length0.8 mm
Seed mass0.153 mg
⚠ sources differ — TRY: 0.153 mg · AusTraits: 0.16 mg · GIFT: 0.15 mg
Seed mass max0.19 mg
Seed mass min0.13 mg
Life cycle & reproduction40
After harvest regrowth rateSlow
Bloom periodMid Summer
Coppice potentialNo
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typewater+wind
⚠ sources differ — AusTraits: anemochory hydrochory · LEDA: agochor · GIFT: unspecialized
Flower colourbrown
⚠ sources differ — GIFT: brown · USDA: Green
Flower conspicuousNo
Flower length max3.9 mm
Flower length min2.2 mm
Flower width max2 mm
Flower width min1 mm
Flowering endOct
Flowering startJul
Flowering timeyynnnnnnyyyy
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formtuberous geophyte
Life spanperennial
Lifespan categoryShort
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedNo
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formcryptophyte
Reproduction asexualpresent
Resprout abilityNo
Seed spread rateSlow
Seedling vigorLow
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateRapid
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment32
Active growth periodSummer and Fall
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatesubtropical
Climberself-supporting
Elevation max2 100 m
Elevation mean1 125 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureMedium
Fruit colouryellow
Fruit fleshinessdry
Fruit typenut
⚠ sources differ — AusTraits: nut · GIFT: achene
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb
Growth form USDARhizomatous
Habitat GIFTÁrea Antrópica
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionNo
Low growing grassNo
Mycorrhiza typenon-mycorrhizal
Root depth min10 in
Shape and orientationSemi-Erect
Small grainNo
Woodinessnon-woody
Physiology & chemistry21
Anaerobic toleranceLow
C:N ratioMedium
Caco3 toleranceMedium
Cold stratification requiredYes
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceLow
Frost free days min90 days
Moisture useLow
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC4
Precipitation max55 in
Precipitation min14 in
Salinity toleranceLow
Shade toleranceHigh
Soil pH max7 pH
Soil pH min5 pH
Specific leaf area (SLA)28.26 mm²/mg
Temperature min42 °F
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound3 489 173 per lb
ToxicityNone
Veneer productNo
Other traits9
Diaspore typefruit
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceYes
Planting density max18 000 per acre
Planting density min11 000 per acre
Seeds per fruit101-1000
Shoot orientationerect
03Chemical composition41 compounds
Compounds documented for Cyperus esculentus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Wax monoesters2
Dicarboxylic acids1
Monosaccharides1
Cinnamic acids and derivatives1
Disaccharides $ Polysaccharides1
Documented compounds41 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (r,r,r)-alpha-tocopherol | present | FoodAtlas | |
| calcium(0) | present | FoodAtlas | |
| CARBOHYDRATE | present | FoodAtlas | |
| carotenoid | present | FoodAtlas | |
| copper(0) | present | FoodAtlas | |
| Covi-Ox | present | LOTUS | |
| D-Xylose | present | NPASS | |
| Ethyl hexadecanoate | present | LOTUS | |
| ferulic acid | present | FoodAtlas | |
| flavonoid | present | FoodAtlas |
05DNA & barcoding39 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyperus esculentus has left across the world's sequence archives.
At a glance
DNA specimens39
Marker genes7
GenBank sequences10
eDNA detections23
Countries6
The DNA barcodea real sequence read deposited for this species
ATCGAGTCTTTGAACGCAAGTTGCGCCCGGAGGACCCTCCCGAGGGCACGCCTGCCTGGGCGTTAGAAGCCCATCAACGCTCGGTCGCCC …
Cyperus esculentus voucher UNKARCyProd5 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL2★rbcLa★ITS8★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT · NCBI
The complete instruction manual Cyperus esculentus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size586 800 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Cyperus esculentus0.59 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 108 n = 54
Chromosome records18–2082n range108median108mode15records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1087×CCDB · cyper-only · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants +2
CCDB · cyper-only — 1287
CCDB · cyper-only — Heiser, C. B. & T. W. Whitaker1948
CCDB · book-fedorov — Hicks 1929
CCDB · book-fedorov — Heiser, Whitaker 1948
CCDB · book-atlas-flowering-plants — Tanaka 1937
CCDB · CromoCat 2015 — Hicks, G. C. (1929). Cytological studies in Cyperus, Eleocharis, Dulichium, and Eriophorum. Bot. Gaz. 88: 132-149.
GIFT · GIFT (floras)
2n 2084×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1
CCDB · cyper-only — Sharma, A. K.1970
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn75-78 — Sharma 1970
GIFT · GIFT (floras)
2n 183×CCDB · cyper-only · CCDB · book-fedorov · CCDB · CromoCat 2015
CCDB · cyper-only — Suzuka, O.1953
CCDB · book-fedorov — Suzuka 1953 (L. 1961)
CCDB · CromoCat 2015 — Suzuka, O. (1953). Chromosome numbers in pharmaceutical plants. II. Seiken Zihô (Rept. Kihara Inst. Biol. Res.) 6: 79
2n 961×GIFT · GIFT (floras)
GIFT · GIFT (floras)
n 546×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78
CCDB · cyper-only — Rath, S. P. & S. N. Patnaik1975
CCDB · cyper-only — Rath, S. P. & S. N. Patnaik1978a
CCDB · ipcn-api-dl — Rath, S. P. & S. N. PATNAIK. 1975. Cytological studies in Cyperaceae. Proc. Indian Sci. Congr. Assoc. 62: 127–128.
CCDB · ipcn-api-dl — Rath, S. P. & S. N. PATNAIK. 1978. Cytological studies in Cyperaceae with special reference to its taxonomy II. Cytologia 43: 643–653.
CCDB · book-ipcn75-78 — Rath & Patnaik 1978
CCDB · book-ipcn75-78 — Rath & Patnaik 1975
n 1045×CCDB · cyper-only · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · cyper-only — Sharma, A. K. & A. K. Sarkar19671968
CCDB · cyper-only — Sharma, A. K.1970
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn67-71 — SHARMA, A., & A.K. SARKAR (Editors). 1967-68. Chromosome number reports of plants in Annual Report, Cytogenetics Laboratory, Department of"li"otany, University of Calcutta. The Research Bulletin. 2: 38-Q8.
CCDB · book-ipcn75-78 — Sharma 1970
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
08Occurrence & distribution
Record type21 209 records
Wild obs. + sensor15 057
Museum / vouchered5 951
Cultivated / captive6
Other195
Origin
Native22
Introduced303
Range
Area of Occupancy AOO43 000 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy72% within 1 km
≤100 m 6 016≤1 km 2 863≤10 km 3 096>10 km 280
12 255 georeferenced · 2 802 without coordinates
Open the mapobservation + sensor15 057
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy57% within 1 km
≤100 m 694≤1 km 608≤10 km 803>10 km 162
2 267 georeferenced · 3 684 without coordinates
Open the institutions mapphysical evidence5 951
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 5
5 georeferenced · 1 without coordinates
Open the mapnot free-living6
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions226 of 415 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Philadelphia, US | 257 |
| Bronx, US | 216 |
| Saint Louis, US | 200 |
| Québec, CA | 189 |
| Wuzhou, CN | 168 |
| Durango, MX | 149 |
| Mexico City, MX | 130 |
| BIO-UNIPIlocation not on record | 110 |
| Chongqing Museumlocation not on record | 109 |
| Ann Arbor, US | 105 |
| MeiseBGlocation not on record | 102 |
| Austin, US | 91 |
| Guasave, MX | 77 |
| Riverside, US | 73 |
| Tampa, US | 71 |
| Flagstaff, US | 68 |
| ASUlocation not on record | 67 |
| Mexico City, MX | 65 |
| University of Stellenboschlocation not on record | 64 |
| LaCarto/IGATE/UAClocation not on record | 64 |
| Porto Alegre, BR | 63 |
| San Diego, US | 63 |
| International Salmonella Centre (W.H.O.)location not on record | 63 |
| Kew, GB | 60 |
| NSMKlocation not on record | 57 |
| Odawara, JP | 50 |
| South Kensington, GB | 49 |
| Jena Microbial Resource Collectionlocation not on record | 48 |
| Fort Worth, US | 48 |
| Universidade Federale do Rio Grande do Sullocation not on record | 44 |
| Brisbane, AU | 39 |
| Allentown, US | 39 |
| Albuquerque, US | 39 |
| LSF/FSA/UAClocation not on record | 38 |
| Montréal, CA | 38 |
| La Paz, MX | 38 |
| LEA/FSA/UAClocation not on record | 38 |
| Claremont, US | 36 |
| College Park, US | 35 |
| BDBClocation not on record | 34 |
| New Haven, US | 33 |
| Williamsburg, US | 31 |
| Wlocation not on record | 30 |
| Canadian Department of Agriculturelocation not on record | 29 |
| Santa Barbara, US | 29 |
| Bangkok, TH | 29 |
| Baroda, IN | 29 |
| Phoenix, US | 27 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 27 |
| Miami, US | 25 |
| Kochi, JP | 24 |
| Berlin, DE | 23 |
| Davis, US | 23 |
| EL PASO, US | 22 |
| Provincia di Livornolocation not on record | 22 |
| Museo Entomologico de Leonlocation not on record | 22 |
| Auckland, NZ | 22 |
| Christchurch, NZ | 22 |
| Jackson, US | 22 |
| Irvine, US | 22 |
| ISAlocation not on record | 22 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 21 |
| San Luis Obispo, US | 20 |
| Mount Annan, AU | 20 |
| Juriquilla, MX | 19 |
| LDlocation not on record | 19 |
| Green Bay, US | 18 |
| Puerto Ayora, EC | 18 |
| Kawasaki Shi Tama Ku, JP | 17 |
| Ciudad de México, MX | 17 |
| Forest Herbarium Ibadan (FHI)location not on record | 17 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 17 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 17 |
| Cuiabá, BR | 17 |
| Chapingo, MX | 16 |
| Acadia Universitylocation not on record | 15 |
| Madison, US | 15 |
| Montréal, CA | 15 |
| Saint John, CA | 15 |
| WAGlocation not on record | 14 |
| Frankfurt am Main | 14 |
| US | 14 |
| McWane Science Centerlocation not on record | 14 |
| Xiamen, CN | 14 |
| Chiba, JP | 13 |
| Barcelona, ES | 13 |
| PUC-RSlocation not on record | 13 |
| Torreón, MX | 13 |
| Montecillo, Texcoco, MX | 13 |
| Université Lavallocation not on record | 13 |
| San Angelo, US | 13 |
| CASlocation not on record | 12 |
| GB | 12 |
| Zapopan, MX | 12 |
| Université de Bordeauxlocation not on record | 12 |
| Yaoundé, CM | 12 |
| Tlalnepantla, MX | 12 |
| BClocation not on record | 12 |
| Chadron, US | 11 |
| Toronto, CA | 11 |
| Leiden University Medical Centerlocation not on record | 11 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 11 |
| Davenport, US | 11 |
| Dekalb, US | 11 |
| Knoxville, US | 10 |
| Morelia, MX | 10 |
| Sagamihara, JP | 10 |
| Dresden, DE | 10 |
| Fayetteville, US | 10 |
| Pittsburg, US | 10 |
| Jardín Botánico de Bogotá José Celestino Mutis (JBB)location not on record | 10 |
| Austin, US | 9 |
| Valdosta State Universitylocation not on record | 9 |
| Lubbock, US | 9 |
| Lincoln, US | 9 |
| MAlocation not on record | 9 |
| National Institute of Biological Resourceslocation not on record | 9 |
| Moscow State Universitylocation not on record | 9 |
| BAYLUlocation not on record | 9 |
| Denton, US | 9 |
| GJOlocation not on record | 9 |
| US | 9 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 9 |
| UFMSlocation not on record | 8 |
| Istituto Agrario Castelnuovolocation not on record | 8 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 8 |
| WTUlocation not on record | 8 |
| New Brunswick, US | 8 |
| Altos de Pipe, VE | 8 |
| UFSClocation not on record | 8 |
| Logan, US | 8 |
| Aarhus, DK | 8 |
| Hermosillo, MX | 8 |
| Norfolk, US | 8 |
| Blumenau, BR | 8 |
| Tuscaloosa, US | 8 |
| Zacatecas, MX | 8 |
| Moscow, US | 8 |
| CJBGlocation not on record | 7 |
| Burlington, US | 7 |
| Whitewater, US | 7 |
| Columbia, US | 7 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 7 |
| Paris, FR | 7 |
| Armidale, AU | 7 |
| GZUlocation not on record | 7 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 7 |
| Tsukuba, JP | 7 |
| Entomological Society of Latvialocation not on record | 7 |
| Puebla, MX | 7 |
| Staten Island, US | 6 |
| Texas Lutheran Universitylocation not on record | 6 |
| Mississippi State, US | 6 |
| GAlocation not on record | 6 |
| Brussel, BE | 6 |
| UnBlocation not on record | 6 |
| CICYTEXlocation not on record | 6 |
| National Museums of Kenyalocation not on record | 6 |
| Henderson State Universitylocation not on record | 6 |
| AUAlocation not on record | 6 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 6 |
| Plocation not on record | 6 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 6 |
| Zürich, CH | 6 |
| EFGlocation not on record | 5 |
| Chicago, US | 5 |
| Fortaleza, BR | 5 |
| Pomona Collegelocation not on record | 5 |
| Hobart, AU | 5 |
| UFESlocation not on record | 5 |
| Brasília, BR | 5 |
| University of Southern Mississippilocation not on record | 5 |
| Ensenada, MX | 5 |
| Millersville, US | 5 |
| Parthenon Tama History Museumlocation not on record | 5 |
| UTFPR-CPlocation not on record | 5 |
| Universidade Federal de Santa Catarinalocation not on record | 4 |
| Chaguaramas, TT | 4 |
| St. Augustine, TT | 4 |
| Uppsala, SE | 4 |
| Portland, US | 4 |
| Zürich, CH | 4 |
| Nijmegen, NL | 4 |
| DOI/NPS, Greenbelt Parklocation not on record | 4 |
| Boise, US | 4 |
| Autlán de Navarro, MX | 4 |
| Lord Fairfax Community Collegelocation not on record | 4 |
| Wellington, NZ | 4 |
| Bloomington, US | 4 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 4 |
| Culiacán, MX | 4 |
| Provo, US | 4 |
| Oskarshamn, SE | 4 |
| UNITINSlocation not on record | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| UFRPElocation not on record | 4 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 4 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 4 |
| Ciudad de México, MX | 4 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 4 |
| National Biodiversity Institute, Costa Ricalocation not on record | 4 |
| Mérida, MX | 4 |
| Bando, JP | 4 |
| Canberra, AU | 4 |
| Denver, US | 4 |
| Turlock, US | 4 |
| Brussels, BE | 4 |
| DanBIFlocation not on record | 4 |
| CNF-UFHBlocation not on record | 4 |
| València, ES | 4 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 3 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 3 |
| St. Paul, US | 3 |
| Cheney, US | 3 |
| FUVATESlocation not on record | 3 |
| Philadelphia, US | 3 |
| HNBlocation not on record | 3 |
| Universidad Nacional de Colombia (UNAL)location not on record | 3 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 3 |
| Adelaide, AU | 3 |
| Salzburg, AT | 3 |
| UEMAlocation not on record | 3 |
| Vancouver, CA | 3 |
| Area de Conservacion Guanacastelocation not on record | 3 |
| León, NI | 3 |
| Beijing, CN | 3 |
| MEXUlocation not on record | 3 |
| Trois-Rivières, CA | 3 |
| Richmond, US | 3 |
| University of Wisconsinlocation not on record | 3 |
| US | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Mexico City, MX | 3 |
| IDElocation not on record | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| Arizona Western Collegelocation not on record | 3 |
| Tomioka, JP | 3 |
| GMBAlocation not on record | 3 |
| Taipei, TW | 3 |
| Royal Botanical Gardenslocation not on record | 3 |
| Campo Mourão, BR | 3 |
| UFSJlocation not on record | 3 |
| Keene State Universitylocation not on record | 3 |
| Northridge, US | 3 |
| UFPRlocation not on record | 3 |
| JBRJlocation not on record | 3 |
| Hudson, US | 3 |
| Edmonton, CA | 2 |
| Pullman, US | 2 |
| Salamanca, ES | 2 |
| Banyoles, ES | 2 |
| Angwin, US | 2 |
| UFOPlocation not on record | 2 |
| DULlocation not on record | 2 |
| H-Diewaldlocation not on record | 2 |
| UNESP, Campus São José Rio Prêtolocation not on record | 2 |
| Federal University of Espírito Santolocation not on record | 2 |
| Universität Basel, Herbariumlocation not on record | 2 |
| Omachi Alpine Museumlocation not on record | 2 |
| Fairfax, US | 2 |
| Vitoria, ES | 2 |
| Université du Lomélocation not on record | 2 |
| Weber State Universitylocation not on record | 2 |
| Arcata, US | 2 |
| H-Hohlalocation not on record | 2 |
| Maringá, BR | 2 |
| Oswego, US | 2 |
| Feira de Santana, BR | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| Honolulu, US | 2 |
| Salvador, BR | 2 |
| Chapel Hill, US | 2 |
| Sanda, JP | 2 |
| Corvallis, US | 2 |
| Cape Town, ZA | 2 |
| Paleontological Collectionlocation not on record | 2 |
| Bogotá, D.C., CO | 2 |
| IPHAMETRAlocation not on record | 2 |
| Pocatello, US | 2 |
| NO DISPONIBLElocation not on record | 2 |
| Görlitz, DE | 2 |
| LGlocation not on record | 2 |
| Anchorage, US | 2 |
| TAIElocation not on record | 2 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 2 |
| Kirksville, US | 2 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 2 |
| Henderson, US | 2 |
| University of Tennessee at Chattanoogalocation not on record | 2 |
| San Isidro, AR | 2 |
| BFLlocation not on record | 2 |
| Durham, US | 2 |
| USFSlocation not on record | 2 |
| Laboratorio de Ictiologialocation not on record | 2 |
| LBVlocation not on record | 2 |
| Olocation not on record | 2 |
| UNESP-FCAlocation not on record | 2 |
| UFERSAlocation not on record | 2 |
| Smithfield, AU | 2 |
| Masindi, UG | 2 |
| Granada, ES | 2 |
| BRNUlocation not on record | 2 |
| BRLUlocation not on record | 2 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 2 |
| LfUlocation not on record | 2 |
| Dover, US | 2 |
| Karlsruhe, DE | 2 |
| UNICAMPlocation not on record | 2 |
| Santa Cruz, US | 2 |
| Osaka, JP | 1 |
| UNESP-FCAVlocation not on record | 1 |
| Universidad de Autonoma de Baja Californialocation not on record | 1 |
| Springfield, US | 1 |
| Cruz das Almas, BR | 1 |
| EAlocation not on record | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| La Paz, BO | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| WINlocation not on record | 1 |
| Museo civico di Ecologia e Storia naturale di Marano sul Panarolocation not on record | 1 |
| arosemena tola, EC | 1 |
| Université National du Béninlocation not on record | 1 |
| Tempe, US | 1 |
| The University of Arizonalocation not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| UC_PESHlocation not on record | 1 |
| VENlocation not on record | 1 |
| Quito, EC | 1 |
| GENTlocation not on record | 1 |
| Glocation not on record | 1 |
| Stockholm, SE | 1 |
| Instituto de Pesquisas Ambientaislocation not on record | 1 |
| Mérida, MX | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Rotorua, NZ | 1 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 1 |
| Herbier National du Gabonlocation not on record | 1 |
| San Francisco, US | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| Royal Ontario Museumlocation not on record | 1 |
| Caldwell, US | 1 |
| Uniwersytet Wrocławskilocation not on record | 1 |
| Badajoz, ES | 1 |
| Buenos Aires, AR | 1 |
| Pamplona, ES | 1 |
| Lausanne, CH | 1 |
| Tilburg, NL | 1 |
| Tapachula, MX | 1 |
| Johnson City, US | 1 |
| Toluca, MX | 1 |
| Cenargenlocation not on record | 1 |
| Hamilton, US | 1 |
| Due West, US | 1 |
| Walla Walla, US | 1 |
| Chicago, US | 1 |
| Missoula, US | 1 |
| Chicago, US | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Clemson, US | 1 |
| Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record | 1 |
| Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| CIIDIRlocation not on record | 1 |
| H-Meierottlocation not on record | 1 |
| Universidad Pablo de Olavidelocation not on record | 1 |
| Cambridge, US | 1 |
| HEMlocation not on record | 1 |
| UEMlocation not on record | 1 |
| Long Beach, US | 1 |
| Durham, US | 1 |
| Cambridge, US | 1 |
| Mount Pleasant, US | 1 |
| Santiago de Compostela, ES | 1 |
| LINUlocation not on record | 1 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 1 |
| Conway, US | 1 |
| TAFORI-LSRClocation not on record | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Göteborg, SE | 1 |
| Teresina, BR | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Botanic Gardenlocation not on record | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Brasília, BR | 1 |
| Fredericksburg, US | 1 |
| MHNAIXlocation not on record | 1 |
| UFBAlocation not on record | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Nagatoro-machi, Chichibu-gun, JP | 1 |
| Antiguo Cuscatlán, SV | 1 |
| FPMZBlocation not on record | 1 |
| Victoria, CA | 1 |
| Macomb, US | 1 |
| Pretoria, ZA | 1 |
| UFMGlocation not on record | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 1 |
| KIRMlocation not on record | 1 |
| Turku, FI | 1 |
| VALElocation not on record | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Universidade Federal do Maranhãolocation not on record | 1 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 1 |
| USP-IBlocation not on record | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| IPA/SPlocation not on record | 1 |
| UNESP-IBILCElocation not on record | 1 |
| UFAClocation not on record | 1 |
| Ivano-Frankivsk, UA | 1 |
| Alicante, ES | 1 |
| Jurica-Suchy Nature Museumlocation not on record | 1 |
| CPATSAlocation not on record | 1 |
| Managua, NI | 1 |
415 institutions · 5 456 of 5 951 vouchered records shown · 475 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA23 detections
Where the DNA of Cyperus esculentus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found23
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 23 detections have coordinates
Open the map6 countries0
Emergent, wet clay shore dominated by Leersi…Sandy shoreFloodplain/Thicket
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median19.7 °C 15.0–24.4
Seasonal swing summer↔winter14.6 °C
Max temp (day)24.8 °C 20.3–27.9
Min temp (night)16.3 °C 10.4–21.7
Precipitation81.6 mm/mo 11.2–242
Air humidity59.6 % 57.7–69.0
Moisture balance-36.5 mm/mo -120–92.6
Vapour deficit930 Pa 705–1,137
Wind speed3.10 m/s 1.90–3.80
Cloud cover38.7 % 14.1–46.7
CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.