Cyperus eragrostis
Lam. · speciesAt a glance
Occurrence records56 354
Data sources11
Biological traits61
DNA specimens19
eDNA detections10
Sources11 archives
Databases and archives Cyperus eragrostis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility56 354 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics19 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources61 traits
Chemical compositionLOTUS7 compounds
Occurrence & distributionGBIF56 354 records
Environmental DNA2 datasets · 5 countries10 detections
DNA & barcodingBOLD · NCBI19 specimens
Genome at a glanceCCDB2n = 42
01Narrative
Cyperus eragrostis, le Souchet robuste, est une plante herbacée de la famille des Cypéracées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYAusTraitsLEDAGIFTWCVP
Size & morphology23
Fruit length1.2 mm
⚠ sources differ — AusTraits: 1.2 mm · GIFT: 1 mm
Fruit length max1.3 mm
Fruit length min1 mm
Fruit width0.5 mm
Fruit width max0.6 mm
Fruit width min0.4 mm
Leaf length max500 mm
Leaf length min2 mm
Leaf mass73.8 mg
Leaf mass per area69.72 g/m2
Leaf size1 058 mm²
Leaf width4 mm
⚠ sources differ — AusTraits: 4 mm · GIFT: 6 mm
Leaf width max10 mm
Leaf width min2 mm
Plant height0.6 m
⚠ sources differ — GIFT: 0.6 m · AusTraits: 0.95 m · TRY: 0.7 m
Plant height max1.4 m
Plant height min0.2 m
Seed length1 mm
Seed length max1 mm
Seed length min1 mm
Seed mass0.115 mg
⚠ sources differ — TRY: 0.115 mg · AusTraits: 0.13 mg · LEDA: 0.093 mg · GIFT: 0.113 mg
Seed mass max0.14 mg
Seed mass min0.1 mg
Life cycle & reproduction20
Deciduousnessn.d.
⚠ sources differ — TRY: n.d. · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typeanimal+anthrochory+water+wind
⚠ sources differ — AusTraits: anemochory anthrochory hydrochory zoochory · GIFT: unspecialized
Flower length max2.5 mm
Flower length min2 mm
Flower width max1.5 mm
Flower width min1 mm
Flowering endAug
Flowering startApr
Flowering timeyynnnnnnyyyy
Life formperennial or rhizomatous geophyte
Life spanperennial
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formcryptophyte
Reproduction asexualpresent
Reproductive maturity1 years
Resprouting capacityresprouts
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 400 m
Elevation mean400 m
Elevation min0 m
Epiphyteterrestrial
Fruit typenut
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb
Habitat GIFTÁrea Antrópica, Campo Limpo, Palmeiral
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC4
⚠ sources differ — TRY: C4 · GIFT: C3
Other traits4
Diaspore typefruit
Plant support typefree-standing
Seeds per fruit101-1000
Shoot orientationerect
03Chemical composition7 compounds
Compounds documented for Cyperus eragrostis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Noreudesmane sesquiterpenoids3
Aromatic polyketides with side chains1
Documented compounds7 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 2-Acetyl-4,8-dihydro-5-methylbenzo[1,2-b:5,4-b']difuran-4,8-dione | present | LOTUS | |
| 2-Prop-1-en-2-ylfuro[3,2-f][1]benzofuran-4,8-dione | present | LOTUS | |
| 3-[(Z)-heptadec-8-enyl]-2-hydroxy-5-methoxycyclohexa-2,5-diene-1,4-dione | present | LOTUS | |
| 5-Methyl-2-prop-1-en-2-yl-2,3,5,6-tetrahydrofuro[3,2-f][1]benzofuran-4,8-dione | present | LOTUS | |
| BENZO(1,2-b:5,4-b')DIFURAN-4,8-DIONE, 2,3-DIHYDRO-2-ISOPROPENYL-5-METHYL-, (-)- | present | LOTUS | |
| Benzo[1,2-b:5,4-b']difuran-4,8-dione, 2-[1-(hydroxymethyl)vinyl]-5-methyl- | present | LOTUS | |
| Cyperaquinone | present | LOTUS |
05DNA & barcoding19 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyperus eragrostis has left across the world's sequence archives.
At a glance
DNA specimens19
Marker genes5
GenBank sequences10
eDNA detections10
Countries7
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTGGGCGTTAGAAGCCC …
Cyperus eragrostis voucher CCDB-23112-A06 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL4★rbcLa★ITS6★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Cyperus eragrostis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 42 n = 21
Chromosome records42–422n range42median42mode8records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 428×CCDB · nw-europe-fl · CCDB · fl-europaea · CCDB · cyper-only +4
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4313
CCDB · fl-europaea — Kliphuis &
CCDB · cyper-only — 223Kliphuis, E. & J. H. Wieffering1972
CCDB · cyper-only — Bokhari, F. S.1979
CCDB · ipcn-api-dl — Bokhari, F. S. 1979. Karyotype and dose tolerance studies in Cyperaceae and Juncaceae. Cytologia 44: 103–109.
CCDB · book-ipcn72 — KLIPHUIS, E . & J.H. WIEFFERING. 1972. Chromosome numbers of some Angiosperms from the South of France. Acta Bot. Neer!. 21: 598-604.
CCDB · eflora
CCDB · CromoCat 2015 — Dalgaard, V. (1986b). Chromosome numbers in flowering plants from Madeira. Willdenowia 16: 221-240.
2n 431×CCDB · cyper-only
CCDB · cyper-only — Dalgaard, V.1986
08Occurrence & distribution
Record type56 354 records
Wild obs. + sensor51 491
Museum / vouchered4 506
Cultivated / captive50
Other307
Origin
Native150
Introduced9 977
Range
Area of Occupancy AOO96 012 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy66% within 1 km
≤100 m 20 789≤1 km 7 019≤10 km 13 968>10 km 612
42 388 georeferenced · 9 103 without coordinates
Open the mapobservation + sensor51 491
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy64% within 1 km
≤100 m 505≤1 km 727≤10 km 648>10 km 41
1 921 georeferenced · 2 585 without coordinates
Open the institutions mapphysical evidence4 506
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy
no georeferenced coordinates · 50 records without
Open the mapnot free-living50
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions149 of 253 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| San Diego, US | 212 |
| Jardín Botánico de Bogotá José Celestino Mutis (JBB)location not on record | 183 |
| Riverside, US | 168 |
| Mount Annan, AU | 161 |
| Christchurch, NZ | 149 |
| Museo Entomologico de Leonlocation not on record | 141 |
| Claremont, US | 140 |
| Odawara, JP | 114 |
| BIO-UNIPIlocation not on record | 111 |
| BDBClocation not on record | 100 |
| Adelaide, AU | 100 |
| Brisbane, AU | 99 |
| Auckland, NZ | 94 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 93 |
| Santa Barbara, US | 77 |
| Davis, US | 73 |
| San Luis Obispo, US | 70 |
| Armidale, AU | 63 |
| Porto Alegre, BR | 50 |
| Wellington, NZ | 49 |
| Barcelona, ES | 49 |
| Corvallis, US | 48 |
| MAlocation not on record | 44 |
| MeiseBGlocation not on record | 42 |
| ISAlocation not on record | 41 |
| Canberra, AU | 41 |
| Pretoria, ZA | 41 |
| Canadian Department of Agriculturelocation not on record | 40 |
| Hobart, AU | 40 |
| CASlocation not on record | 40 |
| Badajoz, ES | 40 |
| Kawasaki Shi Tama Ku, JP | 39 |
| UNIVASFlocation not on record | 38 |
| SLU Artdatabankenlocation not on record | 38 |
| US | 36 |
| Vitoria, ES | 34 |
| Irvine, US | 33 |
| Arcata, US | 32 |
| WTUlocation not on record | 32 |
| ASUlocation not on record | 31 |
| Sanda, JP | 30 |
| Kensington, AU | 30 |
| València, ES | 30 |
| CICYTEXlocation not on record | 28 |
| Flagstaff, US | 27 |
| St. Augustine, TT | 26 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 25 |
| Angwin, US | 25 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 25 |
| Tsukuba, JP | 22 |
| Córdoba, AR | 22 |
| San Sebastián, ES | 19 |
| Rotorua, NZ | 19 |
| Severin-McDaniel Insect Collectionlocation not on record | 19 |
| BClocation not on record | 18 |
| Kew, GB | 17 |
| Kochi, JP | 17 |
| Moscow State Universitylocation not on record | 15 |
| Santa Cruz, US | 14 |
| University of Stellenboschlocation not on record | 14 |
| Entomological Society of Latvialocation not on record | 13 |
| LDlocation not on record | 13 |
| John T. Waterhouse Herbariumlocation not on record | 13 |
| Universidade Federale do Rio Grande do Sullocation not on record | 13 |
| Salamanca, ES | 12 |
| Sagamihara, JP | 12 |
| Los Angeles, US | 11 |
| UChlocation not on record | 11 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 11 |
| Tokushima, JP | 11 |
| Catalina Island Conservancylocation not on record | 10 |
| CJBGlocation not on record | 10 |
| Dresden, DE | 10 |
| Jackson, US | 10 |
| Palmerston, AU | 9 |
| Olocation not on record | 9 |
| Zürich, CH | 9 |
| Portland, US | 8 |
| Fredericton Stock Culture Collectionlocation not on record | 8 |
| Bronx, US | 8 |
| Blumenau, BR | 8 |
| Vancouver, CA | 8 |
| Museo Achille Folettolocation not on record | 7 |
| Sendai, JP | 7 |
| Nijmegen, NL | 7 |
| EL PASO, US | 7 |
| Wollongong, AU | 7 |
| Brussel, BE | 7 |
| Northridge, US | 6 |
| KURAlocation not on record | 6 |
| Wuzhou, CN | 6 |
| Pullman, US | 6 |
| Nagano City, JP | 6 |
| Valdosta State Universitylocation not on record | 6 |
| San Isidro, AR | 6 |
| Oskarshamn, SE | 6 |
| PUC-RSlocation not on record | 6 |
| San Angelo, US | 6 |
| UFMSlocation not on record | 5 |
| Valparaíso, CL | 5 |
| Nagatoro-machi, Chichibu-gun, JP | 5 |
| Natural History Museum Rotterdamlocation not on record | 5 |
| Xian, CN | 5 |
| Madrid, ES | 5 |
| CJBNlocation not on record | 5 |
| Mlocation not on record | 5 |
| Istituto Agrario Castelnuovolocation not on record | 5 |
| Long Beach, US | 5 |
| Görlitz, DE | 5 |
| Saint Louis, US | 5 |
| Fukushima Universitylocation not on record | 5 |
| Pamplona, ES | 5 |
| Laboratorio de Ictiologialocation not on record | 5 |
| Ann Arbor, US | 5 |
| National Institute of Biological Resourceslocation not on record | 5 |
| UFSClocation not on record | 4 |
| Granada, ES | 4 |
| Guangzhou, CN | 4 |
| Hiratsuka City Museumlocation not on record | 4 |
| TAIElocation not on record | 4 |
| Cape Town, ZA | 4 |
| Zürich, CH | 4 |
| South Kensington, GB | 4 |
| Moscow, US | 4 |
| Tomioka, JP | 4 |
| Boise, US | 4 |
| Provo, US | 4 |
| Chicago, US | 4 |
| UNESClocation not on record | 4 |
| Buenos Aires, AR | 4 |
| Victoria, CA | 4 |
| QVMAGlocation not on record | 4 |
| Alicante, ES | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| BRNUlocation not on record | 3 |
| Tilburg, NL | 3 |
| Henderson, US | 3 |
| Batemans Bay, AU | 3 |
| Royal Botanic Garden Edinburghlocation not on record | 3 |
| Taipei, TW | 3 |
| Phoenix, US | 3 |
| Wlocation not on record | 3 |
| Austin, US | 3 |
| Toyama, JP | 3 |
| Bend, US | 3 |
| Logan, US | 3 |
| Universidade Federal de Santa Catarinalocation not on record | 3 |
| Frankfurt am Main | 3 |
| US | 3 |
| J.F.Oberlin Universitylocation not on record | 3 |
| FUVATESlocation not on record | 3 |
| Fort Worth, US | 3 |
| Masindi, UG | 2 |
| Kagoshima, JP | 2 |
| Feira de Santana, BR | 2 |
| La Paz, MX | 2 |
| BISHlocation not on record | 2 |
| BSBIlocation not on record | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| Université de Bordeauxlocation not on record | 2 |
| Nishihara, JP | 2 |
| UC Berkeley, Blue Oak Ranch Reservelocation not on record | 2 |
| Nishihara, JP | 2 |
| Universität Göttingenlocation not on record | 2 |
| Honolulu, US | 2 |
| Palmerston North, NZ | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| UFPElocation not on record | 2 |
| TUR-Alocation not on record | 2 |
| Guasave, MX | 2 |
| Gijón, ES | 2 |
| Mexico City, MX | 2 |
| Osaka, JP | 2 |
| San Jose, US | 2 |
| UNISANTAlocation not on record | 2 |
| Provincia di Livornolocation not on record | 2 |
| Ashland, US | 2 |
| Tlalnepantla, MX | 2 |
| Parthenon Tama History Museumlocation not on record | 2 |
| Portland, US | 2 |
| Tampa, US | 2 |
| Tartu, EE | 2 |
| Parkville, AU | 2 |
| Helsinki, FI | 2 |
| STNFlocation not on record | 2 |
| Paris, FR | 1 |
| UNEMATlocation not on record | 1 |
| Chongqing Museumlocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Bourges, FR | 1 |
| Nantes Culture Collectionlocation not on record | 1 |
| Minia, EG | 1 |
| Omachi Alpine Museumlocation not on record | 1 |
| Salvador, BR | 1 |
| Cambridge, US | 1 |
| GB | 1 |
| Jaén, ES | 1 |
| Toyota city nature sanctuarylocation not on record | 1 |
| Museo civico di Ecologia e Storia naturale di Marano sul Panarolocation not on record | 1 |
| Clemson, US | 1 |
| Fullerton, US | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| Walla Walla, US | 1 |
| AUAlocation not on record | 1 |
| Calabar, NG | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Burlington, US | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record | 1 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| UnBlocation not on record | 1 |
| JP | 1 |
| Ivano-Frankivsk, UA | 1 |
| UEGlocation not on record | 1 |
| Macomb, US | 1 |
| CPATSAlocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| Pamplona, ES | 1 |
| Turlock, US | 1 |
| Brasília, BR | 1 |
| GJOlocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Chiba, JP | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| Stockholm, SE | 1 |
| Bloomington, US | 1 |
| Córdoba, ES | 1 |
| Montréal, CA | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 1 |
| Hokkaido University Museumlocation not on record | 1 |
| UFBAlocation not on record | 1 |
| KNFHClocation not on record | 1 |
| Knoxville, US | 1 |
| KIRMlocation not on record | 1 |
| Coimbra, PT | 1 |
| UFMGlocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Banyoles, ES | 1 |
| Fort Bragg, US | 1 |
| Campo Mourão, BR | 1 |
| GAlocation not on record | 1 |
| Edinburgh, GB | 1 |
| Beijing, CN | 1 |
| Universidad Nacional Mayor de San Marcos, Museo de Historia Naturallocation not on record | 1 |
| Universidade Federal do Maranhãolocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| Ciudad de México, MX | 1 |
253 institutions · 4 145 of 4 506 vouchered records shown · 359 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA10 detections
Where the DNA of Cyperus eragrostis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found10
Studies independent surveys2
Countries5
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 10 detections have coordinates
Open the map5 countries0
Veronica anagallis-aquatica, Eleocharismonte…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.8 °C 13.8–17.7
Seasonal swing summer↔winter10.9 °C
Max temp (day)19.6 °C 16.8–22.3
Min temp (night)13.6 °C 9.50–14.6
Precipitation70.4 mm/mo 2.30–96.5
Air humidity62.4 % 57.6–69.8
Moisture balance-28.0 mm/mo -129–-4.20
Vapour deficit779 Pa 514–820
Wind speed2.90 m/s 2.10–4.10
Cloud cover41.2 % 23.6–54.0
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.