Cyperus dubius

Rottb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Cyperaceae/Cyperus

At a glance

Occurrence records573

Data sources7

Biological traits26

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Cyperus dubius's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility573 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF573 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 112

01Narrative

Cyperus dubius adalah spesies tumbuhan yang tergolong ke dalam famili Cyperaceae. Spesies ini juga merupakan bagian dari ordo Poales. Spesies Cyperus dubius sendiri merupakan bagian dari genus Cyperus. Nama ilmiah dari spesies ini pertama kali diterbitkan oleh Rottb..

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology10

Fruit length2 mm

Fruit width0.8 mm

Leaf length max2 mm

Leaf width3.5 mm

Leaf width max2 mm

Plant height0.5 m

Plant height max0.5 m

Seed mass0.322 mg

⚠ sources differ — TRY: 0.322 mg · GIFT: 0.35 mg

Seed mass max0.35 mg

Seed mass min0.35 mg

Life cycle & reproduction5

Dehiscenceindehiscent

Flowering timeyynnnnnnyyyy

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit typenut

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC4

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyperus dubius has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKY700386.1 ↗386 bp

ACGT

TTTGAACGCAAGTTGCGCCCGAGGGACCCTCCCGAGGGCACGCCTGCCTGGGCGTTAGAAGCCCATCAACGCTCGGTCGCCCGACCGCAT …

Cyperus dubius isolate CYDU_P.C_1of3 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Cyperus dubius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 112 n = 56

Chromosome records22–1122n range112median112mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1125×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-indian_vol2 +1

CCDB · ipcn-api-dl — Tejavathi, D. H. & B. H. M. Nijalingappa. 1990. Cytological studies in some members of Cyperaceae. Cytologia 55: 363–372.

CCDB · ipcn-api-dl — Nijalingappa, B. H. M., N. NAGARAJ & D. H. TEJAVATHI. 1978. In IOPB chromosome number reports LXII. Taxon 27: 519–535.

CCDB · book-ipcn75-78 — Nijalingappa et al. 1978

CCDB · book-indian_vol2 — Nijalingappa, B.H.M. et al. 1978

CCDB · eflora

2n 221×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Subramanian, D. 1988. Cytotaxonomical studies in south Indian Cyperaceae I. Species from the plains. Cytologia 53: 67–72.

2n 961×CCDB · book-indian_vol2

CCDB · book-indian_vol2 — Mehra, P.N. & Sachdeva, S.K. 1971, 1975a c.l24 Rath, S.P. & Patnaik, S.N. 1978a, b

n 484×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Bir, S. S., P. Cheema & M. Sidhu. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 137–139.

CCDB · ipcn-api-dl — Mehra, P. N. & S. K. Sachdeva. 1975. Cytology of some west Himalayan Cyperaceae. Cytologia 40: 497–515.

CCDB · book-ipcn67-71 — MEHRA, P.N . & S.K. SACHDEVA. 1971. In IOPB chromosome reports XXXIII. Taxon 20: 609-614.

CCDB · book-ipcn75-78 — Mehra & Sachdeva 1975

n 492×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Bir, S. S., S. Kamra, M. Sidhu & P. Cheema. 1988. Cytomorphological studies on some members of Cyperaceae from north India. J. Cytol. Genet. 23: 14–37.

CCDB · ipcn-api-dl — Bir, S. S., M. Sidhu & S. Kamra. 1981. In Chromosome number reports LXXIII. Taxon 30: 854.

n 411×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Feinbrun, N. & S. Lerman-Shadder. 1985. Chromosome Number Reports LXXXIX. Taxon 34: 727–730.

n 441×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Bir, S. S., P. Cheema & M. Sidhu. 1988. SOCGI plant chromosome number reports -- VII. J. Cytol. Genet. 23: 219–228.

08Occurrence & distribution

Record type573 records

Wild obs. + sensor242

Museum / vouchered304

Other27

Origin

Native4

Introduced16

Range

Area of Occupancy AOO1 512 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy54% within 1 km

≤100 m 94≤1 km 14≤10 km 58>10 km 34

200 georeferenced · 42 without coordinates

Open the mapobservation + sensor242

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 7≤1 km 1≤10 km 24>10 km 3

35 georeferenced · 269 without coordinates

Open the institutions mapphysical evidence304

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	62
MeiseBGlocation not on record	32
Saint Louis, US	22
Mount Annan, AU	13
HNBlocation not on record	9
Xiamen, CN	6
LBVlocation not on record	6
Plocation not on record	6
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	5
Edinburgh, GB	4
Durban, ZA	4
Herbier National du Gabonlocation not on record	4
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	4
MAlocation not on record	3
Glocation not on record	3
Armidale, AU	3
Paris, FR	2
Bronx, US	2
Conservatoire Botanique National de Mascarinlocation not on record	2
CJBGlocation not on record	2
Pomona Collegelocation not on record	1
GAlocation not on record	1
Pondicherry, IN	1
Seychelles National Herbariumlocation not on record	1
BRLUlocation not on record	1
Museo Entomologico de Leonlocation not on record	1
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	1
Herbarium of the Department of Botany, University of Tokyolocation not on record	1
Wlocation not on record	1
Uppsala, SE	1
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	1
M-VascularPlantslocation not on record	1
National Museums of Kenyalocation not on record	1
Simpson, D. A. (K), 1994.location not on record	1
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	1

35 institutions · 209 of 304 vouchered records shown · 95 without an institution code

09Environmental DNA1 detections

Where the DNA of Cyperus dubius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.7 °C 23.7–23.7

Seasonal swing summer↔winter8.90 °C

Max temp (day)28.2 °C

Min temp (night)18.6 °C

Precipitation128 mm/mo

Air humidity59.8 %

Moisture balance-35.8 mm/mo

Vapour deficit1,176 Pa

Wind speed2.90 m/s

Cloud cover46.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)