Cyperus aggregatus
(Willd.) Endl. · speciesAt a glance
Occurrence records3 603
Data sources8
Biological traits25
DNA specimens1
eDNA detections1
Sources8 archives
Databases and archives Cyperus aggregatus's data was compiled from.
WikipediaWikimedia Foundation3 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility3 603 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics1 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources25 traits
Occurrence & distributionGBIF3 603 records
Environmental DNA1 datasets · 0 countries1 detections
DNA & barcodingBOLD · NCBI1 specimens
01Narrative
Cyperus aggregatus, commonly known as the inflatedscale flatsedge, is a species of sedge that is native to the Americas.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPTRYAusTraitsGIFT
Size & morphology8
Fruit length1.8 mm
Fruit width0.9 mm
Leaf width3.5 mm
Leaf width max6 mm
Leaf width min1 mm
Plant height0.137 m
Plant height max0.6 m
Plant height min0.05 m
Life cycle & reproduction5
Dehiscenceindehiscent
Flowering timeyynnnnnnyyyy
Life formperennial or rhizomatous geophyte
Life spanpere
⚠ sources differ — TRY: pere · AusTraits: perennial · GIFT: perennial
Raunkiær life formhemicryptophyte
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit typenut
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb
Habitat GIFTÁrea Antrópica, Campo de Altitude, Campo de Várzea, Campo Limpo, Cerrado (lato sensu), Floresta de Várzea, Floresta Estacional Semidecidual, Restinga, Vegetação Sobre Afloramentos Rochosos
Woodinessnon-woody
Physiology & chemistry1
Photosynthetic pathwayC3
05DNA & barcoding1 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyperus aggregatus has left across the world's sequence archives.
At a glance
DNA specimens1
Marker genes2
GenBank sequences6
eDNA detections1
Countries1
The DNA barcodea real sequence read deposited for this species
TCGTCGCCTCGAAACACGACCGGGAACACGTAACGTAAAGCCTCCGGGGAGGGGCCCCCTCCCCGGACCCGCCGGCCCCGGCCCCTCGGC …
Cyperus aggregatus voucher LSU:Reid 7620 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★ITS3
plant barcodefungal barcode
08Occurrence & distribution
Record type3 603 records
Wild obs. + sensor623
Museum / vouchered2 919
Other61
Origin
Native692
Introduced393
Range
Area of Occupancy AOO8 300 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy91% within 1 km
≤100 m 374≤1 km 48≤10 km 20>10 km 21
463 georeferenced · 160 without coordinates
Open the mapobservation + sensor623
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy64% within 1 km
≤100 m 283≤1 km 42≤10 km 145>10 km 34
504 georeferenced · 2 415 without coordinates
Open the institutions mapphysical evidence2 919
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions101 of 210 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 242 |
| Porto Alegre, BR | 210 |
| Bronx, US | 155 |
| Université de Bordeauxlocation not on record | 149 |
| Universidade Federale do Rio Grande do Sullocation not on record | 134 |
| University of Stellenboschlocation not on record | 88 |
| Mexico City, MX | 87 |
| Durango, MX | 85 |
| UnBlocation not on record | 77 |
| Altos de Pipe, VE | 75 |
| Mount Annan, AU | 67 |
| Brisbane, AU | 66 |
| Mexico City, MX | 45 |
| UFPElocation not on record | 41 |
| Córdoba, AR | 41 |
| Masindi, UG | 35 |
| UFSClocation not on record | 33 |
| Universidade Federal de Sergipe (UFS)location not on record | 31 |
| JBRJlocation not on record | 30 |
| Brasília, BR | 29 |
| Laboratorio de Ictiologialocation not on record | 29 |
| Austin, US | 29 |
| Guasave, MX | 29 |
| Kew, GB | 28 |
| UFMSlocation not on record | 28 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 27 |
| Armidale, AU | 25 |
| Ann Arbor, US | 25 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 24 |
| Universidade Federal de Santa Catarinalocation not on record | 24 |
| Xiamen, CN | 23 |
| National Biodiversity Institute, Costa Ricalocation not on record | 22 |
| Cenargenlocation not on record | 20 |
| Salvador, BR | 19 |
| Universidad Nacional de Colombia (UNAL)location not on record | 19 |
| UFERSAlocation not on record | 19 |
| Paleontological Collectionlocation not on record | 19 |
| Museu Paraense Emílio Goeldilocation not on record | 19 |
| IPA/SPlocation not on record | 18 |
| Departamento de Sistematica e Ecologialocation not on record | 18 |
| UNIVASFlocation not on record | 18 |
| Brasília, BR | 17 |
| UNICAMPlocation not on record | 17 |
| Feira de Santana, BR | 17 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 15 |
| Ivano-Frankivsk, UA | 15 |
| Blumenau, BR | 15 |
| UFMGlocation not on record | 15 |
| Santa Cruz de la Sierra, BO | 14 |
| Canberra, AU | 13 |
| USP-IBlocation not on record | 13 |
| Antiguo Cuscatlán, SV | 12 |
| San Isidro, AR | 12 |
| UFESlocation not on record | 12 |
| Ciudad de México, MX | 12 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 11 |
| UFBAlocation not on record | 11 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 11 |
| Federal University of Espírito Santolocation not on record | 11 |
| Chaguaramas, TT | 11 |
| MAlocation not on record | 10 |
| CEPLAClocation not on record | 10 |
| Fortaleza, BR | 10 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 8 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 8 |
| Corrientes, AR | 8 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 8 |
| Chapingo, MX | 8 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 8 |
| Chongqing Museumlocation not on record | 7 |
| Cuiabá, BR | 7 |
| UEPAlocation not on record | 7 |
| EL PASO, US | 7 |
| Tampa, US | 7 |
| Chicago, US | 7 |
| Museo Entomologico de Leonlocation not on record | 7 |
| Paris, FR | 7 |
| Jackson, US | 7 |
| Aarhus, DK | 6 |
| Valdosta State Universitylocation not on record | 6 |
| IAPlocation not on record | 6 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 6 |
| Odawara, JP | 6 |
| UFSJlocation not on record | 6 |
| Palmerston, AU | 5 |
| Universidade Federal do Vale do São Franciscolocation not on record | 5 |
| Buenos Aires, AR | 5 |
| Bogotá, D.C., CO | 5 |
| Universidade Federal do Maranhãolocation not on record | 5 |
| Jena Microbial Resource Collectionlocation not on record | 5 |
| Cascavel, BR | 5 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 4 |
| John T. Waterhouse Herbariumlocation not on record | 4 |
| US | 4 |
| PUC-RSlocation not on record | 4 |
| Santarém, BR | 4 |
| Juriquilla, MX | 4 |
| León, NI | 4 |
| VENlocation not on record | 4 |
| Jataí / Setor Industrial, BR | 4 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 4 |
| Loja, EC | 3 |
| Davis, US | 3 |
| Berlin, DE | 3 |
| LDlocation not on record | 3 |
| Ilhéus, BR | 3 |
| UNESClocation not on record | 3 |
| Sucre, BO | 3 |
| Auckland, NZ | 3 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 3 |
| Universidad Nacional de Asunciónlocation not on record | 3 |
| QCNElocation not on record | 3 |
| Universidad de Nariño (UdeNar)location not on record | 3 |
| Fort Worth, US | 3 |
| Stockholm, SE | 3 |
| HUENFlocation not on record | 3 |
| UTFPR-SLlocation not on record | 3 |
| Tuscaloosa, US | 3 |
| Criciúma, BR | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| IECOSlocation not on record | 3 |
| MeiseBGlocation not on record | 2 |
| Campo Mourão, BR | 2 |
| Universiti Sains Malaysialocation not on record | 2 |
| UTFPR-CPlocation not on record | 2 |
| FUVATESlocation not on record | 2 |
| COLlocation not on record | 2 |
| Toyota city nature sanctuarylocation not on record | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Culiacán, MX | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| McWane Science Centerlocation not on record | 2 |
| Pontifícia Universidade Católica do Paranálocation not on record | 2 |
| Moscow State Universitylocation not on record | 2 |
| Christchurch, NZ | 2 |
| UTPLlocation not on record | 2 |
| Sanda, JP | 2 |
| Universidad Nacional Agrarialocation not on record | 2 |
| Teresina, BR | 2 |
| Museum of Zoologylocation not on record | 2 |
| Mérida, MX | 2 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 2 |
| UNITINSlocation not on record | 2 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 2 |
| GB | 2 |
| NSW Office of Environment and Heritagelocation not on record | 2 |
| BMlocation not on record | 2 |
| La Paz, BO | 2 |
| Logan, US | 2 |
| Quito, EC | 2 |
| Universidad de Autonoma de Baja Californialocation not on record | 2 |
| UNESP-IBILCElocation not on record | 2 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 2 |
| Castelar, AR | 2 |
| Londrina, BR | 1 |
| Provo, US | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| UEMlocation not on record | 1 |
| UFAClocation not on record | 1 |
| South Kensington, GB | 1 |
| St. Augustine, TT | 1 |
| Riverside, US | 1 |
| San Angelo, US | 1 |
| Cochabamba, BO | 1 |
| Universität Göttingenlocation not on record | 1 |
| MEXUlocation not on record | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| University of Puerto Rico at Rio Piedraslocation not on record | 1 |
| UFRRJlocation not on record | 1 |
| Sangmiung Universitylocation not on record | 1 |
| Cambridge, US | 1 |
| Tlalnepantla, MX | 1 |
| Pittsburg, US | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
| San José, CR | 1 |
| Maringá, BR | 1 |
| Wlocation not on record | 1 |
| Iquitos, PE | 1 |
| Calabar, NG | 1 |
| Pullman, US | 1 |
| Corvallis, US | 1 |
| Universidade Federal do Espírito Santolocation not on record | 1 |
| Bloomington, US | 1 |
| ASUlocation not on record | 1 |
| Toluca, MX | 1 |
| Cusco, PE | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Seropédica, BR | 1 |
| Badajoz, ES | 1 |
| Hermosillo, MX | 1 |
| MUFALlocation not on record | 1 |
| HEMlocation not on record | 1 |
| Smithfield, AU | 1 |
| Plocation not on record | 1 |
| Tapachula, MX | 1 |
| Uberlândia, BR | 1 |
| INMAlocation not on record | 1 |
| UNESP-RClocation not on record | 1 |
| UFPRlocation not on record | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Zürich, CH | 1 |
| UFRPElocation not on record | 1 |
| OTSlocation not on record | 1 |
| Institut de Recherche pour le Developpement (IRD)location not on record | 1 |
| Zürich, CH | 1 |
| Durham, US | 1 |
| UNESP-ISlocation not on record | 1 |
| Universidad Nacional Autónoma de Honduraslocation not on record | 1 |
| Moscow, US | 1 |
210 institutions · 2 891 of 2 919 vouchered records shown · 28 without an institution code
09Environmental DNA1 detections
Where the DNA of Cyperus aggregatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found1
Studies independent surveys1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 1 detections have coordinates
Open the map0 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.