Cynoglossum officinale
speciesAt a glance
Occurrence records93 341
Data sources14
Biological traits39
DNA specimens35
eDNA detections17
Sources14 archives
Databases and archives Cynoglossum officinale's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility93 341 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics35 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources39 traits
Chemical compositionLOTUS · NPASS33 compounds
Occurrence & distributionGBIF93 341 records
Environmental DNA1 datasets · 5 countries17 detections
DNA & barcodingBOLD · NCBI35 specimens
Genome at a glanceCCDB · GoaT919 Mbp
01Narrative
La Cynoglosse officinale ou la Langue de chien est une plante herbacée de la famille des Boraginacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass53.33 mg
Leaf size31 623 mm²
⚠ sources differ — TRY: 31 623 mm² · LEDA: 1 322 mm² · GIFT: 3 174 mm²
Plant height0.442 m
⚠ sources differ — GIFT: 0.442 m · LEDA: 0.425 m · TRY: 0.187 m
Plant height generative0.55 m
Plant height max1 m
Plant height min0.3 m
Seed length6 mm
Seed mass28.37 mg
Seed mass max39.77 mg
Seed mass min21.84 mg
Life cycle & reproduction13
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typeanimal
Flowering endJul
Flowering startMay
Life formbiennial
Life spanstrict monocarpic bi-annuals and poly-annuals
⚠ sources differ — TRY: strict monocarpic bi-annuals and poly-annuals · LEDA: strict monocarpic bi-annuals and poly-annuals · GIFT: biennial
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number494
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
⚠ sources differ — GIFT: herb · TRY: Stem erect
Habitat GIFTcropfields,desert,oldfields,parks
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry4
Leaf dry-matter content (LDMC)143 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)14.01 mm²/mg
⚠ sources differ — TRY: 14.01 mm²/mg · LEDA: 22.89 mm²/mg · GIFT: 22.4 mm²/mg
Other traits2
Diaspore typegenerative dispersule
Monocarpymonocarp
03Chemical composition33 compounds
Compounds documented for Cynoglossum officinale across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile4 classes
Pyrrolizidine alkaloids22
Arylnaphthalene and aryltetralin lignans1
Purine alkaloids1
Colensane and Clerodane diterpenoids1
Documented compounds33 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| ((1S,7aR)-2,3,5,7a-Tetrahydro-1-hydroxy-1H-pyrrolizin-7-yl)methyl (2S,3S)-2,3-dihydroxy-2-(1-methylethyl)butanoate | present | LOTUS | |
| (+)-Heliotrine | present | NPASS | |
| (-)-Lasiocarpine | present | NPASS | |
| (1-Hydroxy-2,3,5,7a-tetrahydro-1H-pyrrolizin-7-yl)methyl 2-hydroxy-2-(1-hydroxyethyl)-3-methylbutanoate | present | NPASS | |
| (1S,7aR)-2,3,5,7a-Tetrahydro-7-(hydroxymethyl)-1H-pyrrolizin-1-yl (2Z)-2-methyl-2-butenoate | present | LOTUS | |
| (4Z,11S)-4-ethylidene-7-hydroxy-6,7-dimethyl-2,9-dioxa-14-azatricyclo[9.5.1.014,17]heptadecane-3,8-dione | present | NPASS | |
| 2,3,5,6,7,8-hexahydro-1H-pyrrolizin-1-ylmethyl 2,3-dihydroxy-2-(2-methylpropyl)pentanoate | present | LOTUS | |
| 2-Butenoic acid, 2-methyl-, 7-[[2,3-dihydroxy-2-(1-hydroxyethyl)-3-methyl-1-oxobutoxy]methyl]-2,3,5,7a-tetrahydro-1H-pyrrolizin-1-yl ester | present | LOTUS | |
| 7-Angeloylechinatine | present | LOTUS | |
| [(7S,8S)-7-hydroxy-5,6,7,8-tetrahydro-3H-pyrrolizin-1-yl]methyl (2S)-2-hydroxy-2-[(1S)-1-hydroxyethyl]-3-methylbutanoate | present | LOTUS |
05DNA & barcoding35 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cynoglossum officinale has left across the world's sequence archives.
At a glance
DNA specimens35
Marker genes7
GenBank sequences10
eDNA detections17
Countries9
The DNA barcodea real sequence read deposited for this species
CTCGCGAACACGTTCACAAAACGAGGGCTGAGCCGGGCGTGGGGGATTCCTCCTGCACCCGATTCGGATCCTTCCGGTGCTCGGGCAACT …
Cynoglossum officinale voucher ALT23-443 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL5★rbcLa★trnL-F★ITS3★ITS2rpoC1
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Cynoglossum officinale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size919 320 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Cynoglossum officinale0.92 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy2× diploid · measured
Chromosome records24–242n range24median24mode26records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2426×GoaT · Kew Plant DNA C-values Database · CCDB · iber-fl · CCDB · nw-europe-fl +5
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · iber-fl — Caryological study of Spanish Boraginaceae III. Cynoglossum L.s.str. Luque, T. & B. Valdes.Willdenowia15(2): 485-496(1986).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3452
CCDB · poland — Skali?ska M., Czapik R., Piotrowicz M. et al. 1959. Further studies in chromosome numbers of Polish Angiosperms (Dicotyledons). Acta Soc. Bot. Pol. 28, 487-529.
CCDB · poland — Tok? E. 1976. Endosperm and embryo development in Cynoglossum officinale L. Acta Biol. Cracov. Ser. Bot. 19, 47-58.
CCDB · poland — Mizianty M., Frey L. and Mirek Z. 1981. Contribution to the knowledge in the chromosome numbers of Polish vascular plants. Fragm. Flor. Geobot. 27, 19-29.
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1985. Kariologicheskaja kharakteristika nekotorykh vidov poleznykh rastenij flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 6: 3–8.
CCDB · ipcn-api-dl — Mizianty, M., L. Frey & Z. Mirek. 1981. Contribution to the knowledge of the chromosome numbers of Polish vascular plants. Fragm. Florist. Geobot. 27: 19–30.
CCDB · ipcn-api-dl — Markova, M. L. 1989. Chromosome numbers of Bulgarian angiosperms. Fitologija 36: 67–68.
CCDB · ipcn-api-dl — Stepanov, N. V. & E. N. Muratova. 1995. Chromosome numbers of some taxa of higher plants of Krasnoyarsk territory. Bot. Žhurn. (Moscow & Leningrad) 80(6): 114–116.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Mizianti, M., L. Frey & Z. Mirek. 1981. Contribution to the knowledge of the chromosome numbers of Polish vascular plants. Fragm. Florist. Geobot. 27: 19–29.
CCDB · ipcn-api-dl — Krasnoborov, I. M., T. S. Rostovtseva & S. A. Ligus. 1980. Chromosome numbers of some plant species of South Siberia and the Far East. Bot. Zhurn. 65 (5): 659–668.
CCDB · ipcn-api-dl — Gregor, T. & R. Hand. 2007. Chromosomenzahlen von Farn- und Samenpflanzen aus Deutschland 2. Kochia 2: 31–35.
CCDB · ipcn-api-dl — Luque, T. & B. VALDES. 1986. Caryological study of Spanish Boraginaceae III. Cynoglossum L. s. str. Willdenowia 15: 485–496.
CCDB · book-ipcn67-71 — LEVEQUE, M., & R. GORENFLOT. 1969. Prospections caryologiques dans la flore littorale du Boulonnais. Bull. soc. Bot. Nord France 22: 27-58.
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.
CCDB · Cave1959 — Skalinska et al. 1959
CCDB · CromoCat 2015 — Den Brand, C., van, van Meel, F. C. M. & Wieffering, J. H. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIV]. Taxon 28(4): 395-397.
CCDB · CromoCat 2015 — Markova, M. (1987). Kariologicno proucvane na balgarskite predstaviteli na rod Thymus L. I. In: Trudove IV nacionalna konferencija po botanika 1: 38-45.
CCDB · CromoCat 2015 — Markova, M. (1989). Chromosome numbers of Bulgarian Angiosperms. Fitologija 36: 67-68.
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Luque, T. & B. Valdés. (1986). Caryological study of Spanish Boraginaceae III. Cynoglossum L.s.str. Willdenowia 15(2): 485-496.
n 125×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · iber-fl — Caryological study of Spanish Boraginaceae III. Cynoglossum L.s.str. Luque, T. & B. Valdes.Willdenowia15(2): 485-496(1986).
CCDB · ipcn-api-dl — Mizianti, M., L. Frey & Z. Mirek. 1981. Contribution to the knowledge of the chromosome numbers of Polish vascular plants. Fragm. Florist. Geobot. 27: 19–29.
CCDB · book-ipcn67-71 — DELAY, J. 1970. Orophytes. Inf. Ann. Caryosyst. et Cytogenet. 4: 1-16.
CCDB · CromoCat 2015 — Luque, T. & B. Valdés. (1986). Caryological study of Spanish Boraginaceae III. Cynoglossum L.s.str. Willdenowia 15(2): 485-496.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type93 341 records
Wild obs. + sensor87 150
Museum / vouchered5 964
Cultivated / captive40
Other187
Origin
Native4 223
Introduced1 656
Range
Area of Occupancy AOO118 240 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy42% within 1 km
≤100 m 19 759≤1 km 8 143≤10 km 36 827>10 km 1 109
65 838 georeferenced · 21 312 without coordinates
Open the mapobservation + sensor87 150
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy47% within 1 km
≤100 m 420≤1 km 1 148≤10 km 1 594>10 km 187
3 349 georeferenced · 2 615 without coordinates
Open the institutions mapphysical evidence5 964
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 12
13 georeferenced · 27 without coordinates
Open the mapnot free-living40
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions156 of 281 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 301 |
| Uniwersytet Wrocławskilocation not on record | 275 |
| Olocation not on record | 215 |
| LDlocation not on record | 212 |
| BFLlocation not on record | 208 |
| MeiseBGlocation not on record | 192 |
| BIO-UNIPIlocation not on record | 172 |
| Uppsala, SE | 130 |
| Madison, US | 115 |
| Chongqing Museumlocation not on record | 101 |
| Philadelphia, US | 91 |
| Bronx, US | 88 |
| Wuzhou, CN | 85 |
| SLU Artdatabankenlocation not on record | 76 |
| Oskarshamn, SE | 74 |
| Tartu, EE | 65 |
| WTUlocation not on record | 62 |
| GJOlocation not on record | 60 |
| Ann Arbor, US | 59 |
| Turku, FI | 59 |
| Voronezh State Universitylocation not on record | 55 |
| Bern, CH | 54 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 53 |
| Moscow, US | 53 |
| Denver, US | 51 |
| Victoria, CA | 50 |
| Adam Mickiewicz University in Poznańlocation not on record | 50 |
| BRNUlocation not on record | 49 |
| Wlocation not on record | 48 |
| Bloomington, US | 47 |
| Entomological Society of Latvialocation not on record | 45 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 43 |
| Corvallis, US | 43 |
| Boise, US | 42 |
| BDBClocation not on record | 40 |
| Barcelona, ES | 40 |
| TUR-Alocation not on record | 40 |
| MAlocation not on record | 39 |
| Bergen, NO | 39 |
| Spearfish, US | 38 |
| St. Paul, US | 37 |
| Salzburg, AT | 37 |
| Québec, CA | 36 |
| Tallinn, EE | 36 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 36 |
| Vancouver, CA | 35 |
| Albuquerque, US | 35 |
| Bozeman, US | 33 |
| Pocatello, US | 32 |
| Burlington, US | 32 |
| Oulu, FI | 30 |
| Trondheim, NO | 28 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 28 |
| Chadron, US | 27 |
| Saint Louis, US | 26 |
| Missoula, US | 26 |
| DOI/NPS, Greenbelt Parklocation not on record | 25 |
| Logan, US | 25 |
| LfUlocation not on record | 24 |
| Weber State Universitylocation not on record | 22 |
| Zürich, CH | 22 |
| Toronto, CA | 21 |
| Kuopio, FI | 21 |
| Provo, US | 19 |
| Berlin, DE | 19 |
| Uniwersytet Warszawskilocation not on record | 19 |
| Zürich, CH | 18 |
| CJBGlocation not on record | 18 |
| South Kensington, GB | 18 |
| Pullman, US | 17 |
| Mlocation not on record | 17 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 17 |
| Riverside, US | 17 |
| Université Lavallocation not on record | 16 |
| Frankfurt am Main | 16 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 16 |
| València, ES | 16 |
| Görlitz, DE | 16 |
| Provincia di Livornolocation not on record | 15 |
| BClocation not on record | 15 |
| Urumqi, CN | 14 |
| Flagstaff, US | 14 |
| Canadian Department of Agriculturelocation not on record | 14 |
| Green Bay, US | 14 |
| Orem, US | 14 |
| KMNlocation not on record | 13 |
| Pittsburg, US | 12 |
| University of Alberta Museumslocation not on record | 12 |
| Natural History Museum Rotterdamlocation not on record | 11 |
| Davenport, US | 11 |
| Philadelphia, US | 11 |
| Dekalb, US | 11 |
| Helsinki, FI | 11 |
| Caldwell, US | 10 |
| New Haven, US | 10 |
| Uniwersytet Śląski w Katowicachlocation not on record | 10 |
| Paris, FR | 10 |
| Salamanca, ES | 10 |
| New Brunswick, US | 9 |
| Chapel Hill, US | 9 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 9 |
| Porrentruy, CH | 9 |
| Porvoo, FI | 8 |
| Urumqi, CN | 8 |
| Beijing, CN | 8 |
| Montréal, CA | 8 |
| UGentlocation not on record | 7 |
| USFS/BHSClocation not on record | 7 |
| Allentown, US | 7 |
| University of New Hampshirelocation not on record | 7 |
| Madrid, ES | 7 |
| Karlsruhe, DE | 7 |
| Jyväskylä, FI | 7 |
| Bourges, FR | 7 |
| ASUlocation not on record | 7 |
| Durango, US | 6 |
| Chicago, US | 6 |
| Stockholm, SE | 6 |
| Vitoria, ES | 6 |
| Tampa, US | 6 |
| IDElocation not on record | 6 |
| Portland, US | 6 |
| Staten Island, US | 6 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 6 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 6 |
| San Luis Obispo, US | 6 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 6 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 6 |
| McWane Science Centerlocation not on record | 5 |
| Davis, US | 5 |
| Columbia, US | 5 |
| Grand Junction, US | 5 |
| Göteborg, SE | 5 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 5 |
| Millersville, US | 5 |
| TROMlocation not on record | 5 |
| UniKSlocation not on record | 5 |
| DBF-NHMDlocation not on record | 5 |
| WINlocation not on record | 5 |
| University of Lethbridgelocation not on record | 4 |
| University of British Columbialocation not on record | 4 |
| Herb. BBGlocation not on record | 4 |
| Rocky Mountain Biological Laboratorylocation not on record | 4 |
| Tula State Universitylocation not on record | 4 |
| PRClocation not on record | 4 |
| BGBMlocation not on record | 4 |
| Lausanne, CH | 4 |
| University of Stellenboschlocation not on record | 4 |
| San Angelo, US | 3 |
| Acadia Universitylocation not on record | 3 |
| Fayetteville, US | 3 |
| Claremont, US | 3 |
| CASlocation not on record | 3 |
| Badajoz, ES | 3 |
| Emporia, US | 3 |
| College of the Atlantic, Museumlocation not on record | 3 |
| EL PASO, US | 3 |
| Tacoma, US | 3 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| DULlocation not on record | 3 |
| Pamplona, ES | 3 |
| No collectionlocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Dresden, DE | 3 |
| UoB-IBlocation not on record | 3 |
| NMBU:MINAlocation not on record | 3 |
| Phoenix, US | 3 |
| Monastir, TN | 3 |
| Williamsburg, US | 3 |
| GB | 3 |
| Northridge, US | 3 |
| Gijón, ES | 3 |
| US | 3 |
| nlocation not on record | 3 |
| College Park, US | 2 |
| Hamilton, US | 2 |
| Wellington, NZ | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| nbflocation not on record | 2 |
| GZUlocation not on record | 2 |
| USFSlocation not on record | 2 |
| SZUlocation not on record | 2 |
| SEFlocation not on record | 2 |
| Mississippi State, US | 2 |
| Lincoln, US | 2 |
| Cheney, US | 2 |
| Boumlocation not on record | 2 |
| Tilburg, NL | 2 |
| Portland, US | 2 |
| Bend, US | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| Muséum Henri Lecoqlocation not on record | 2 |
| Fargo, US | 2 |
| Podgorica, ME | 2 |
| Xining, CN | 2 |
| Eastern Nevada Landscape Coalitionlocation not on record | 2 |
| BAYLUlocation not on record | 2 |
| Whitewater, US | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Universität Göttingenlocation not on record | 2 |
| BSBIlocation not on record | 2 |
| Nanjing, CN | 2 |
| Fulda, DE | 2 |
| Kunming, CN | 2 |
| US | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Museum of the Rockieslocation not on record | 2 |
| Knoxville, US | 1 |
| New Mexico Museum of Natural History and Sciencelocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| Association des Naturalistes de la Vallée du Loing et du Massif de Fontainebleaulocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| Fort Worth, US | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Garðabær, IS | 1 |
| IPE-CSIClocation not on record | 1 |
| Cambridge, US | 1 |
| Frauenfeld, CH | 1 |
| Tuscaloosa, US | 1 |
| Auckland, NZ | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Henderson, US | 1 |
| Glarus, CH | 1 |
| Finnish Museum of Natural Historylocation not on record | 1 |
| HUN003location not on record | 1 |
| University of Hulllocation not on record | 1 |
| SWlocation not on record | 1 |
| KNFYlocation not on record | 1 |
| Chengdu, CN | 1 |
| Nanjing, CN | 1 |
| Guangzhou, CN | 1 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 1 |
| Tempe, US | 1 |
| Johnson City, US | 1 |
| PrivatHerblocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Kirksville, US | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Ashland, US | 1 |
| University of South Dakotalocation not on record | 1 |
| Pamplona, ES | 1 |
| Campo Mourão, BR | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| Fribourg, CH | 1 |
| CBDClocation not on record | 1 |
| JBAlocation not on record | 1 |
| Namur, BE | 1 |
| KNFHClocation not on record | 1 |
| Christchurch, NZ | 1 |
| Riyadh Municipalitylocation not on record | 1 |
| Sion, CH | 1 |
| Brookings, US | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Brock University (BU)location not on record | 1 |
| Edmonton, CA | 1 |
| Brussel, BE | 1 |
| Bangkok, TH | 1 |
| Montréal, CA | 1 |
| Durham, US | 1 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 1 |
| Guilin, CN | 1 |
| Santa Barbara, US | 1 |
| Kew, GB | 1 |
| Trois-Rivières, CA | 1 |
| Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record | 1 |
| Ypsilanti, US | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 1 |
| Samara National Research Universitylocation not on record | 1 |
| Xiamen, CN | 1 |
| Angwin, US | 1 |
| Norfolk, US | 1 |
| Nijmegen, NL | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| STNFlocation not on record | 1 |
| Austin, US | 1 |
| H-AkrKGlocation not on record | 1 |
281 institutions · 5 254 of 5 964 vouchered records shown · 647 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA17 detections
Where the DNA of Cynoglossum officinale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found17
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 17 detections have coordinates
Open the map5 countries0
Hillside with Pinus, Myosotis, rocky soilin planted conifer woodland
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.8 °C 10.6–20.5
Seasonal swing summer↔winter24.2 °C
Max temp (day)18.8 °C 15.7–26.0
Min temp (night)10.9 °C 3.40–16.1
Precipitation79.6 mm/mo 41.3–83.2
Air humidity55.6 % 46.7–62.8
Moisture balance-50.4 mm/mo -96.1–-11.2
Vapour deficit748 Pa 616–1,035
Wind speed3.70 m/s 2.10–5.30
Cloud cover39.4 % 34.3–52.2
CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.