Cyanea asplenifolia — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Campanulaceae/Cyanea

At a glance

Occurrence records19

Data sources8

Biological traits18

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Cyanea asplenifolia's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility19 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Occurrence & distributionGBIF19 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Cyanea asplenifolia is a flowering plant in the Campanulaceae family. The IUCN has classified the species as critically endangered. It is native to the Hawaiian Islands.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Leaf length max420 mm

Leaf length min220 mm

Leaf width max25 mm

Leaf width min10 mm

Plant height max2 m

Plant height min1.3 m

Life cycle & reproduction4

Dehiscenceindehiscent

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit typeberry

Growth formshrub

Woodinesswoody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyanea asplenifolia has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJX500339.1 ↗821 bpUSA

ACGT

GATCGCGGCGACGTGGGCGGTTCGCCGCCGGCGACGTCGCGAGAAGTCCACTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAG …

Cyanea asplenifolia internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL1ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type19 records

Museum / vouchered19

Range

Area of Occupancy AOO16 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 8

8 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence19

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BISHlocation not on record	8
Honolulu, US	8
Madison, US	1

3 institutions · 17 of 19 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Cyanea asplenifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–12.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C

Min temp (night)8.20 °C

Precipitation79.6 mm/mo

Air humidity57.3 %

Moisture balance-38.4 mm/mo

Vapour deficit733 Pa

Wind speed5.80 m/s

Cloud cover36.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.