Cyanea acuminata

(Gaudich.) Hillebr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Campanulaceae/Cyanea

At a glance

Occurrence records18

Data sources10

Biological traits20

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Cyanea acuminata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility18 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF18 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Cyanea acuminata is a rare species of flowering plant known by the common names Honolulu cyanea. It is endemic to Oahu, where there are no more than 250 individuals remaining.Bruegmann, M. M. & V. Caraway. (2003). Cyanea acuminata. IUCN Red List of Threatened Species. IUCN 2010. www.iucnredlist.org . Retrieved on 24 February 2011. It is a federally listed endangered species of the United States. Like other Cyanea it is known as haha in Hawaiian.Hawaiian Native Plant Genera: Cyanea This Hawaiian lobelioid is a shrub up to 2 meters tall. It grows in wet forests and on slopes and ridges in the Koʻolau and Waiʻanae Mountains of Oahu.USFWS. Cyanea acuminata Five year Review. July 2009. The remaining plants are divided among 18 subpopulations which are threatened by damage to their habitat from feral pigs and goats, rats, and exotic plants such as Maui pamakani (Ageratina adenophora), kukui (Aleurites moluccanus), and ti plant (Cordyline fruticosa). Other threats to the plant and its habitat include fire and trampling by military personnel. Botanists are hopeful that there are many more than 250 plants remaining in unsurveyed areas of the island.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Fruit length max6 mm

Fruit length min4 mm

Leaf length max320 mm

Leaf length min110 mm

Leaf width max90 mm

Leaf width min30 mm

Plant height max2 m

Plant height min0.3 m

Life cycle & reproduction4

Dehiscenceindehiscent

Life formsubshrub or shrub

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit typeberry

Growth formshrub

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cyanea acuminata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

rbcLDQ285261.1 ↗1 072 bp

ACGT

ACCAAAAATATCCAAATTTTTGCGAAAATTATCCAATTCCAAATAAATGTCCGATAGCAAGGTGATCGGTTAATGAAATAAGAACCGGGA …

Cyanea acuminata atpB-rbcL intergenic spacer, partial sequence; and ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

07Deep time~1.46 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin1.46 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type18 records

Wild obs. + sensor1

Museum / vouchered17

Range

Area of Occupancy AOO20 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 3≤10 km 1

4 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BISHlocation not on record	7
Honolulu, US	6
Claremont, US	3
Vancouver, CA	1

4 institutions · 17 of 17 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Cyanea acuminata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)