Curcuma zedoaria

(Christm.) Roscoe · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Zingiberales/Zingiberaceae/Curcuma

At a glance

Occurrence records295

Data sources12

Biological traits13

DNA specimens39

eDNA detections39

Sources12 archives

Databases and archives Curcuma zedoaria's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility295 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS · NPASS486 compounds

Occurrence & distributionGBIF295 records

Environmental DNA2 datasets · 4 countries39 detections

DNA & barcodingBOLD · NCBI39 specimens

Genome at a glanceCCDB2n = 64

01Narrative

La zédoaire est une espèce de plantes à fleurs du genre Curcuma et de la famille des Zingibéracées. C'est une plante herbacée rhizomateuse vivace originaire de l'Inde et de l'Indonésie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height0.8 m

Plant height max1 m

Life cycle & reproduction3

Life formperennial or rhizomatous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition486 compounds

Compounds documented for Curcuma zedoaria across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Germacrane sesquiterpenoids66

Guaiane sesquiterpenoids41

Bisabolane sesquiterpenoids27

Aromadendrane sesquiterpenoids25

Elemane sesquiterpenoids25

Documented compounds486 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-2-Octanol	present	NPASS
(+)-3-Carene	present	NPASS
(+)-3-Thujone	present	NPASS
(+)-4-Carene	present	NPASS
(+)-alpha-Carene	present	NPASS
(+)-alpha-Muurolene	present	NPASS
(+)-alpha-Pinene	present	NPASS
(+)-beta-Caryophyllene	present	NPASS
(+)-Calarene	present	LOTUS
(+)-Camphene	present	LOTUS

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Curcuma zedoaria has left across the world's sequence archives.

At a glance

DNA specimens39

Marker genes5

GenBank sequences10

eDNA detections39

Countries4

The DNA barcodea real sequence read deposited for this species

ITSMF589490.1 ↗227 bp

ACGT

GCATTGTCGCTTTTGCTCCATGCTTTGTCGGCATTGAGCGCGGAAGTTGGCCCCGTGTGCCCTCGGGCACAGTCGGTCGAAGAGCGGGTA …

Curcuma zedoaria isolate SS0033MT01 internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK★rbcL5★ITS5★ITS2

animal barcodeplant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Curcuma zedoaria carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 64 n = 32

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 641×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — DHSp

2n 1051×CCDB · kew

CCDB · kew — Leong-Skornickova J, Sida O, Jarolimova V, Sabu M, Fer T, Travnicek P, Suda J. 2007. Chromosome numbers and genome size variation in Indian species of Curcuma (Zingiberaceae). Annals of Botany 100: 505-526.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type295 records

Wild obs. + sensor141

Museum / vouchered153

Cultivated / captive1

Origin

Native1

Introduced1

Range

Area of Occupancy AOO828 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 64≤1 km 19≤10 km 12>10 km 10

105 georeferenced · 36 without coordinates

Open the mapobservation + sensor141

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 4≤1 km 2≤10 km 7

13 georeferenced · 140 without coordinates

Open the institutions mapphysical evidence153

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guilin, CN	17
Paris, FR	16
Beijing, CN	15
Xiamen, CN	10
FJIDClocation not on record	8
Kunming, CN	3
South Kensington, GB	3
Guangzhou, CN	2
Ischia Marine Centrelocation not on record	2
Jena Microbial Resource Collectionlocation not on record	2
Berlin, DE	2
Chengdu, CN	2
Guangzhou, CN	2
Shanghai, CN	1
Bronx, US	1
Uberlândia, BR	1
UFRRJlocation not on record	1
Tampa, US	1
Wuhan, CN	1
Nanjing, CN	1
Istituto Agrario Castelnuovolocation not on record	1
Honolulu, US	1
Burlington, US	1
UTFPR-DVlocation not on record	1
South China Normal Universitylocation not on record	1
Stockholm, SE	1
Saint Louis, US	1
BISHlocation not on record	1
UNESP-ISlocation not on record	1
National Biodiversity Institute, Costa Ricalocation not on record	1
UNIVILLElocation not on record	1
Edinburgh, GB	1
TAIElocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Fort Worth, US	1
OTSlocation not on record	1

36 institutions · 107 of 153 vouchered records shown · 35 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA39 detections

Where the DNA of Curcuma zedoaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys2

Countries4

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.5 °C 21.5–25.1

Seasonal swing summer↔winter8.20 °C

Max temp (day)25.8 °C 25.8–30.5

Min temp (night)16.2 °C 16.2–19.3

Precipitation90.5 mm/mo 90.5–109

Air humidity58.9 % 52.0–63.1

Moisture balance-18.0 mm/mo -18.0–-17.8

Vapour deficit1,051 Pa 1,051–1,616

Wind speed1.80 m/s 1.70–5.20

Cloud cover43.7 % 25.2–43.7

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)