Cupressus macrocarpa

Hartw. ex Gordon · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Pinopsida/Pinales/Cupressaceae/Cupressus

At a glance

Occurrence records3 419

Data sources15

Biological traits50

DNA specimens0

eDNA detections14

Sources15 archives

Databases and archives Cupressus macrocarpa's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 419 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources50 traits

Chemical compositionLOTUS · NPASS175 compounds

Occurrence & distributionGBIF3 419 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT13.9 Gbp

01Narrative

Hesperocyparis macrocarpa is a coniferous tree. It is commonly known as the Monterey cypress and is one of several species of cypress trees endemic to California. In New Zealand, where it is also widespread, it is simply known as "macrocarpa". The Monterey cypress is found naturally only on the Central Coast of California. The natural distributional range of the species during modern times is confined to two small relict populations near Carmel, California, at Cypress Point in Pebble Beach and at Point Lobos.C. Michael Hogan & Michael P. Frankis. 2009. Monterey Cypress: Cupressus macrocarpa, GlobalTwitcher.com ed. N. Stromberg Historically during the peak of the last ice age, Monterey cypress would have likely comprised a much larger forest that extended much further north and south.Axelrod, D. I. (1982). AGE AND ORIGIN OF THE MONTEREY ENDEMIC AREA. Madroño, 29(3), 127–147.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTAusTraitsTRY

Size & morphology19

Fruit length35 mm

⚠ sources differ — AusTraits: 35 mm · GIFT: 27 mm

Fruit width24 mm

Fruit width max40 mm

Fruit width min10 mm

Leaf length2 mm

Leaf length max10 mm

Leaf length min2 mm

Leaf width max4 mm

Leaf width min3 mm

Plant height17.5 m

⚠ sources differ — GIFT: 17.5 m · AusTraits: 20 m · TRY: 23.71 m

Plant height max25 m

Seed length4.67 mm

Seed length max6 mm

Seed length min5 mm

Seed mass7.07 mg

⚠ sources differ — TRY: 7.07 mg · GIFT: 8.19 mg

Seed mass max40 mg

Seed mass min4.65 mg

Seed width max3 mm

Seed width min2 mm

Life cycle & reproduction15

Deciduousnessevergreen

Dispersal typewind

Flower length max6 mm

Flower length min3 mm

Flower width max3 mm

Flower width min2 mm

Flowering endApr

Flowering startFeb

Life spanperennial

Lifespan years300 years

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formphanerophyte

Reproduction asexualabsent

Sex typemonoecious

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climberself-supporting

Elevation mean3 600 m

Epiphyteterrestrial

Fruit colourbrown

Fruit typestrobilus

⚠ sources differ — AusTraits: strobilus · GIFT: cone

Growth formtree

Habitat GIFTCoastal

Leaf formscale-like

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density400 mg/cm³

Other traits1

Seeds per fruit101-1000

03Chemical composition175 compounds

Compounds documented for Cupressus macrocarpa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Bufadienolides46

Cholane steroids5

Simple indole alkaloids5

Himachalane sesquiterpenoids4

Labdane diterpenoids $ Norlabdane diterpenoids4

Documented compounds175 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Guaia-6,9-diene	present	LOTUS
(+)-Isocupressic acid	present	LOTUS
(+)-Sabinene	present	LOTUS
(-)-Arctigenin	present	NPASS
(-)-Matairesinol	present	NPASS
(1R,4S,9S,10R,13S)-5,5,9,13-tetramethyltetracyclo[11.2.1.01,10.04,9]hexadec-14-ene	present	LOTUS
(1S,2R,3'S,5S,6S,9S,11R,14R,15S,17R,19R,21R)-2,3',6-trimethylspiro[16,18-dioxahexacyclo[15.3.1.02,15.05,14.06,11.015,19]henicosane-21,2'-oxirane]-9-ol	present	NPASS
(1S,2R,5S,7S,10R,11S,14R,15R)-16-ethenyl-10,14-dimethyl-18-oxapentacyclo[13.3.2.01,14.02,11.05,10]icos-16-ene-5,7-diol	present	NPASS
(1S,3aR,8aR)-1-methyl-4-methylidene-7-propan-2-yl-2,3,3a,5,6,8a-hexahydro-1H-azulene	present	LOTUS
(1S,4S,5R)-1,8-dimethyl-4-prop-1-en-2-ylspiro[4.5]dec-8-ene	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cupressus macrocarpa has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

eDNA detections14

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLLC405327.1 ↗1 254 bp

ACGT

TTATTATACTCCGGAATATCAGACCAAAGATACTGATATCTTGGCAGCATTCCGAGTCACTCCTCAACCTGGAGTGCCCCCCGAAGAAGC …

Hesperocyparis macrocarpa CRISP10690 chloroplast rbcL gene for ribulose bisphosphate carboxylase large chain, partial sequence, sequence_id: CRISP10690_100

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL4

plant barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Cupressus macrocarpa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size13 887 600 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Cupressus macrocarpa13.89 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records22–222n range22median22mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 226×GoaT · Kew Plant DNA C-values Database · CCDB · nw-europe-fl · CCDB · ipcn-api-dl +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1575

CCDB · ipcn-api-dl — Ohri, D. & T. N. Khoshoo. 1986. Genome size in gymnosperms. Pl. Syst. Evol. 153: 119–132.

CCDB · ipcn-api-dl — Li, L. c. & Y. x. Fu. 1996. Studies on the karyotypes and the cytogeography of Cupressus (Cupressaceae). Acta Phytotax. Sin. 34(2): 117–123.

CCDB · eflora

CCDB · Cave1958 — Hunziker 1958b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

07Deep time~1.69 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin1.69 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type3 419 records

Wild obs. + sensor3 140

Museum / vouchered277

Cultivated / captive2

Origin

Native2

Introduced888

Range

Area of Occupancy AOO8 008 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤100 m 370≤1 km 720≤10 km 1 941>10 km 4

3 035 georeferenced · 105 without coordinates

Open the mapobservation + sensor3 140

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 6≤1 km 24≤10 km 33>10 km 3

66 georeferenced · 211 without coordinates

Open the institutions mapphysical evidence277

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions37 of 53 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	47
Bronx, US	35
Claremont, US	19
Wellington, NZ	10
Canadian Department of Agriculturelocation not on record	9
Riverside, US	9
Wuzhou, CN	9
Vitoria, ES	7
WTUlocation not on record	6
San Jose State University, Museum of Birds and Mammalslocation not on record	6
Durango, MX	6
Saint Louis, US	6
MAlocation not on record	5
Blumenau, BR	4
UTPLlocation not on record	4
TAFORI-LSRClocation not on record	4
MeiseBGlocation not on record	4
LDlocation not on record	4
Tampa, US	4
Edinburgh, GB	3
Fredericton Stock Culture Collectionlocation not on record	3
San Francisco, US	3
Chicago, US	3
Los Angeles, US	3
South Kensington, GB	3
New Haven, US	3
Boise, US	2
Irvine, US	2
Stockholm, SE	2
Provo, US	2
Instituto Nacional de Biodiversidad del Ecuadorlocation not on record	2
Fullerton, US	2
Córdoba, AR	2
Victoria, CA	2
València, ES	2
College of the Atlantic, Museumlocation not on record	2
arosemena tola, EC	2
Philadelphia, US	2
UFRRJlocation not on record	2
Moscow, US	1
BSBIlocation not on record	1
Long Beach, US	1
GB	1
QCNElocation not on record	1
UFOPlocation not on record	1
Badajoz, ES	1
Angwin, US	1
Cambridge, US	1
Beijing, CN	1
Toronto, CA	1
UNESClocation not on record	1
Lincoln, US	1
US	1

53 institutions · 259 of 277 vouchered records shown · 18 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA14 detections

Where the DNA of Cupressus macrocarpa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.5 °C 18.0–22.9

Seasonal swing summer↔winter9.20 °C

Max temp (day)24.2 °C 23.6–24.7

Min temp (night)18.4 °C 15.4–21.3

Precipitation0.9 mm/mo 0.3–1.50

Air humidity65.5 % 64.7–66.4

Vapour deficit835 Pa 729–941

Cloud cover20.4 % 11.3–29.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cupressus macrocarpa

At a glance

Sources15 archives

Size & morphology19

Life cycle & reproduction15

Diet & foraging1

Habitat & environment11

Physiology & chemistry3

Other traits1

Compound class profile5 classes

Documented compounds175 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

At a glance

When this lineage existed

Record type3 419 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions37 of 53 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 419 records