Culiseta longiareolata

(Macquart, 1838) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Culicidae/Culiseta

At a glance

Occurrence records3 312

Data sources7

Biological traits2

DNA specimens184

eDNA detections190

Sources7 archives

Databases and archives Culiseta longiareolata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 312 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI190 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics184 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 312 records

Environmental DNA1 datasets · 10 countries190 detections

DNA & barcodingBOLD184 specimens

01Narrative

Culiseta longiareolata is a species of mosquito.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)haematophagous

Feeding guild (larval)saprophagous

05DNA & barcoding184 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Culiseta longiareolata has left across the world's sequence archives.

At a glance

DNA specimens184

BINs2

Marker genes5

eDNA detections190

Countries16

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P612 bp consensus176 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

24Cmostly conserved

167Tmostly conserved

TAGTAGGGACTTCATTAAGTCTTCTTATTCGAGCAGAATTAAGACACCCAGGAATATTTATTGGGAATGATCAAATTTATAATGTAATTG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.66%

Haplotypes17

BINs2

Most divergent pair0.98%

EuropeAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Psorophora pallescenssame family9.4%Culex vaganssame family9.6%Aedes guatemalasame family10.8%Anopheles oswaldoisame family10.9%Aedes allotecnonsame family10.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS216S18S-3P

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type3 312 records

Wild obs. + sensor2 560

Museum / vouchered752

Origin

Native49

Range

Area of Occupancy AOO6 232 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 164≤1 km 130≤10 km 212>10 km 24

530 georeferenced · 2 030 without coordinates

Open the mapobservation + sensor2 560

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 7≤1 km 1≤10 km 2

10 georeferenced · 742 without coordinates

Open the institutions mapphysical evidence752

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	626
Sydney, AU	44
Cape Town, ZA	8
Departamento de Zoologia, Universidad de La Lagunalocation not on record	7
Museum of National History ISLAMABAD, PAKISTANlocation not on record	4
Durban Natural Science Museumlocation not on record	3
ULLlocation not on record	3
South Kensington, GB	3
University of Queensland Insect Collectionlocation not on record	2
Helsinki, FI	1

10 institutions · 701 of 752 vouchered records shown · 49 without an institution code

09Environmental DNA190 detections

Where the DNA of Culiseta longiareolata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found190

Studies independent surveys1

Countries10

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 190 detections have coordinates

Open the map10 countries0

14. Artificial - Terrestrial | 14.5 Urban Ar…8. Desert | 8.1. Hot Desert

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.6 °C 11.5–25.1

Seasonal swing summer↔winter16.8 °C

Max temp (day)23.8 °C 15.9–30.2

Min temp (night)14.2 °C 7.20–17.8

Precipitation39.2 mm/mo 9.50–117

Air humidity57.2 % 32.1–61.7

Moisture balance-68.0 mm/mo -193–54.7

Vapour deficit911 Pa 560–2,157

Wind speed3.10 m/s 2.60–4.20

Cloud cover37.0 % 7.40–44.6

CHELSA 1981–2010, ~9 km grid, at location & month of 55 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Culiseta longiareolata

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type3 312 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 312 records