Cucurbita argyrosperma — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Cucurbitales/Cucurbitaceae/Cucurbita

At a glance

Occurrence records805

Data sources8

Biological traits17

DNA specimens2

eDNA detections12

Sources8 archives

Databases and archives Cucurbita argyrosperma's data was compiled from.

GBIFGlobal Biodiversity Information Facility805 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources17 traits

Occurrence & distributionGBIF805 records

Environmental DNA1 datasets · 0 countries12 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · NCBI≈255 Mbp

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass46.73 mg

⚠ sources differ — TRY: 46.73 mg · GIFT: 40.36 mg

Seed mass max62.1 mg

Seed mass min32.28 mg

Life cycle & reproduction6

Life formannual

Life spanannual

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formtherophyte

Self fertilizationpresent

Habitat & environment7

Climateseasonally dry tropical

Climberobligatory

Elevation max1 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Vine

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cucurbita argyrosperma has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections12

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW374689.1 ↗301 bpMexico

ACGT

GTCTTTGAACGCAAGTTGCGCCCGGAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCTGCCCCCACATACAACACCCA …

Cucurbita argyrosperma voucher IBUG:176419 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK5rbcL4ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB · NCBI

The complete instruction manual Cucurbita argyrosperma carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈255 122 959 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Cucurbita argyrosperma0.26 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 401×CCDB · kew

CCDB · kew — Sisko M, Ivancic A, Bohanec B. 2003. Genome size analysis in the genus Cucurbita and its use for determination of interspecific hybrids obtained using the embryo-rescue technique. Plant Science 165: 663-669.

n 201×CCDB · Cave1958

CCDB · Cave1958 — Whitaker 1956

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type805 records

Wild obs. + sensor257

Museum / vouchered345

Cultivated / captive6

Other197

Origin

Native138

Range

Area of Occupancy AOO1 840 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 109≤1 km 42≤10 km 16>10 km 8

175 georeferenced · 82 without coordinates

Open the mapobservation + sensor257

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 76≤10 km 13

89 georeferenced · 256 without coordinates

Open the institutions mapphysical evidence345

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 6

6 georeferenced

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Centro de Investigación Regional Centro, Campo Experimental Bajío, Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuariaslocation not on record	195
Chapingo, MX	35
Juriquilla, MX	28
Mexico City, MX	26
Austin, US	12
Durango, MX	9
Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record	7
Saint Louis, US	5
National Biodiversity Institute, Costa Ricalocation not on record	5
Villa de Etla, MX	4
Guasave, MX	3
Tepatitlán de Morelos, MX	3
Tampa, US	2
Chicago, US	2
San José, CR	2
Mérida, MX	2
Logan, US	1
Puebla, MX	1
Austin, US	1
San Francisco de Campeche, MX	1
Burlington, US	1

21 institutions · 345 of 345 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA12 detections

Where the DNA of Cucurbita argyrosperma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.