Cucumis melo
speciesAt a glance
Occurrence records13 417
Data sources15
Biological traits60
DNA specimens45
eDNA detections55
Sources15 archives
Databases and archives Cucumis melo's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility13 416 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI55 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics45 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
foodatlascompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page8 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources60 traits
Chemical compositionFooDB · FoodAtlas · LOTUS · NPASS5 831 compounds
Occurrence & distributionGBIF · PBDB13 417 records
Environmental DNA2 datasets · 13 countries55 detections
DNA & barcodingBOLD · NCBI45 specimens
Genome at a glanceCCDB · GoaT · NCBI743 Mbp
Deep timePBDB1 fossils
01Narrative
Le melon est une espèce de plantes à fleurs de la famille des Cucurbitacées. C'est une plante herbacée annuelle, originaire d'Afrique intertropicale, et largement cultivée comme plante potagère pour son fruit comestible. La tige n'est pas volubile mais la plante peut grimper en s'accrochant à des supports grâce à des vrilles simples. Des mutants sont connus à entre-nœuds courts. Les feuilles sont généralement entières assez arrondies, parfois assez fortement découpées. Le terme désigne aussi le fruit climactérique lui-même très savoureux, sucré et parfumé. À ne pas confondre avec le « Melon d'eau » (pastèque), mais cette expression désigne aussi certaines variétés de melons à chair blanche.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesTRYAusTraitsLEDAGIFTWCVP
Size & morphology25
Fruit length30 mm
Fruit length max66 mm
Fruit length min43 mm
Fruit width30 mm
Leaf length65 mm
Leaf length max95 mm
Leaf length min18 mm
Leaf mass per area109 g/m2
Leaf width55 mm
Leaf width max102 mm
Leaf width min27 mm
Petiole length5.25 cm
Plant height1.44 m
⚠ sources differ — GIFT: 1.44 m · TRY: 2.25 m
Plant height max6 m
Plant height min0 m
Seed length5 mm
Seed length max4.5 mm
Seed mass6.67 mg
⚠ sources differ — TRY: 6.67 mg · AusTraits: 7.04 mg · GIFT: 24.21 mg
Seed mass max96.5 mg
Seed mass min3.13 mg
Seed volume11 mm³
Seed volume max11 mm³
Seed volume min11 mm³
Seed width2.75 mm
Seed width max2 mm
Life cycle & reproduction14
Dispersal typeanimal+self
⚠ sources differ — AusTraits: barochory endozoochory · LEDA: endozoochor · GIFT: unspecialized
Flower colouryellow
Flowering endSep
Flowering startJun
Flowering timeyyyyyyyyyyyy
Life formscrambling annual
Life spanannual
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprouting capacityfire_killed
Self fertilizationabsent
Sex typemonoecious
⚠ sources differ — AusTraits: monoecious · GIFT: bisexual
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climateseasonally dry tropical
Climberobligatory
Elevation max2 350 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessfleshy
Fruit typeberry
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: herb · TRY: Vine
Habitat GIFTCerrado (lato sensu), Floresta Ombrófila (= Floresta Pluvial)
Leaf compoundnesssimple
Leaf shapeovate
Mycorrhiza type0.00000354
Succulenceno
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Other traits2
Seeds per fruit101-1000
Shoot orientationprostrate
03Chemical composition5 831 compounds
Compounds documented for Cucumis melo across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingGourds
Compound class profile5 classes
Aminoacids173
Unsaturated fatty acids59
Glycerophospholipids57
Pyridine alkaloids57
pteridine alkaloids40
Documented compounds5 831 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Sucrose | 75,100 mg/100 g | FooDB | |
| (Z,Z)-9,12-Octadecadienoic acid | 39,140 mg/100g | FooDB | |
| D-Fructose | 38,800 mg/100 g | FooDB | |
| D-Mannose | 33,900 mg/100 g | FooDB | |
| alpha-Linolenic acid | 20,975 mg/100g | FooDB | |
| Elaidic acid | 14,085 mg/100g | FooDB | |
| Sugars | 8,120 mg/100g | FooDB |
05DNA & barcoding45 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cucumis melo has left across the world's sequence archives.
At a glance
DNA specimens45
Marker genes6
GenBank sequences10
eDNA detections55
Countries13
The DNA barcodea real sequence read deposited for this species
CTTACCAGTCTTGATCGTTACAAAGGACGATGCTATGGAATCGAGCCTGTTGCTGGAGAAGAAAATCAATATATTGCTTATGTAGCTTAT …
Cucumis melo voucher KAUMB37 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL10★rbcLa★ITS★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Cucumis melo carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size743 280 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Cucumis melo0.74 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy2× diploid · measured
Chromosome records14–242n range24median24mode73records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2466×GoaT · Kew Plant DNA C-values Database · CCDB · nw-europe-fl · CCDB · book-ipcn65 +7
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2193
CCDB · book-ipcn65 — Shimotsuma 1965
CCDB · ipcn-api-dl — Sidhu, M. & S. S. Bir. 1983. Karyological studies on weeds on cultivable lands in Punjab, India. Trop. Plant Sci. Res. 1: 1–13.
CCDB · ipcn-api-dl — Sidhu, M. K. 1979. Distributional and cytological studies of the weed flora of cultivable fields of Patiala district (Panjab). Ph.D. Thesis, Patiala. 1-230. 1979.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1979. Cytological observations in weed fiora of orchards of Paticla district, Punjab. Recent Res. Pl. Sci. (New Delhi). 7: 261–271.
CCDB · ipcn-api-dl — Ayyangar, K. R. 1976. Karyo-taxonomy, karyo-genetics and karyogeography of Cucurbitaceae. In P.K.K. Nair (editor), Aspects of Plant Sciences Today & Tomorrow's Printers & Publishers, New Delhi. 2: 85–116.
CCDB · ipcn-api-dl — Sen, R. & K. B. Datta. 1978. Cytological studies in some Indian cultivated varieties of Cucumis L. J. Cytol. Genet. 13: 16–22.
CCDB · ipcn-api-dl — Li, R. q. 1989. Studies on Karyotypes of Vegetables in China
CCDB · ipcn-api-dl — Yadava, K. S., A. K. Singh & H. C. Arya. 1984. Cytogenetic investigation in Cucumis L. I. Meiotic analysis in twenty- four Cucumis species. Cytologia 49: 1–9.
CCDB · ipcn-api-dl — Ramachandran, C. & V. S. Seshadri. 1986. Cytological analysis of the genome of cucumber (Cucumis sativus L.) and muskmelon (Cucumis melo L.). Z. Pflanzenz;auucht. 96: 25–38.
CCDB · ipcn-api-dl — Ramachandran, C. & R. K. J. Narayan. 1990. Satellite DNA specific to knob heterochromatin in Cucumis metuliferus (Cucurbitaceae). Genetica 80: 129–138.
CCDB · ipcn-api-dl — Ezura, H., H. Amagai, K. Yoshioka & K. Oosawa. 1992. Efficient production of tetraploid melon (Cucumis melo L.) by somatic embryogenesis. Jap. J. Breed. 42: 137–144.
CCDB · ipcn-api-dl — Yamaguchi, J. & T. Shiga. 1993. Characteristics of regenerated plants via protoplast electrofusion between melon (Cucumis melo) and pumpkin (interspecific hybrid, Cucurbita maxima @x C. moschata). Jap. J. Breed. 43: 173–182.
CCDB · ipcn-api-dl — Chen, R. y. 1993. (editor), Chromosome Atlas of Chinese Fruit Trees and Their Close Wild Relatives. Chromosome Atlas Chin. Princ. Econ. Pl. 1.
CCDB · ipcn-api-dl — Sen, R. & K. B. DATTA. 1976. Intervarietal differences in karyotypes of Cucumis melo L. (Cucurbitaceae). Proc. Indian Sci. Congr. Assoc. 63:127.
CCDB · ipcn-api-dl — Zhang, Y. b. 2005. Staining and slide-preparing technique of mitotic chromosomes and its use in karyotype determination of Cucumis melo L. Acta Bot. Boreal.-Occid. Sin. 25(9): 1735–1739.
CCDB · ipcn-api-dl — Samuel, R., S. Balasubramaniam & W. Morawetz. 1995. The karyology of some cultivated Cucurbitaceae of Sri Lanka. Ceylon J. Sci., Biol. Sci. 24(1): 17–22.
CCDB · ipcn-api-dl — SINGH, A. K. & K. S. Yadava. 1984. Cytogenetics of Cucumis L. IV. Comparative study of natural and induced polyploids. Cytologia 49: 183–192.
CCDB · ipcn-api-dl — Beevy, S. S. & P. Kuriachan. 1996. Chromosome numbers of south Indian Cucurbitaceae and a note on the cytological evolution in the family. J. Cytol. Genet. 31(1): 65–71.
CCDB · ipcn-api-dl — Ghaffari, S. M. & M. A. Shahbake. 1995. Chromosome studies of some varieties of muskmelon (Cucumis melo L.). J. Sci. Univ. Tehran 21(1): 65–70.
CCDB · ipcn-api-dl — Murin, A. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · book-ipcn67-71 — TRIVEDI, R.N., & R.P. ROY. 1970. Cytological studies in Cucumis and Citrullus. Cytologia 35: 561-569.
CCDB · book-ipcn75-78 — Sen & Datta 1976
CCDB · book-ipcn75-78 — Murin 1978
CCDB · book-ipcn73-74 — SINGH, A.K. & R.P. ROY. 1974. Karyological studies in Cucumis (L.). Caryologia 27: 153-160.
CCDB · book-indian_vol1 — Bir, S.S. & Sidhu, M. 1980
CCDB · book-indian_vol1 — Bir, S.S. & Sidhu, M. 1974
CCDB · book-indian_vol1 — Kozbuchow, Z.A. (Fedorov); Lewi- tsky (Fedorov) ; McKay, J.W. 1930, 1931 ; Passmore, S.F. 1930; Whitaker, T.W. 1930, 1933b ; Morinaga, T. & Fukushima, E. 1931a ; Yamaha, G. & Suematsu, S. 1936 ; Kurita, M. 1939; Bhadhuri, P.N. & Bose, P.C. 1947 ; Delay, C. 1947 ; Batra, S. 1952; Macchia, F. & Pacucci, G. 1961 ; Roy, R.P. & Misbra, A.R. 1962; Vasil, I.K. 1962; Sen, R. & Datta, K.B. /1976
CCDB · book-indian_vol1 — Singh, A.K. & Roy, R.P. 1974
CCDB · book-indian_vol1 — Ayyangar, K.R. 1969; Sanjappa, M. 1979
CCDB · book-indian_vol1 — Trivedi, R.N. & Roy, R.P. 1970
CCDB · book-fedorov — Apaparn:H 1939r
CCDB · book-fedorov — KOJKyXOB 1925, 1930, 1934
CCDB · book-fedorov — JleBHTCKHii (BaBBJIOB 1925)
CCDB · book-fedorov — McKay 1930, 1931
CCDB · book-fedorov — Passmore 1930
CCDB · book-fedorov — Whitaker 1930, 1933b
CCDB · book-fedorov — Morinaga, Fukushima 1931a
CCDB · book-fedorov — Yamaha, Suematsu 1936
+11 more references
2n 147×CCDB · book-ipcn73-74 · CCDB · book-indian_vol1 · CCDB · book-fedorov +2
CCDB · book-ipcn73-74 — SINGH, A.K. & R.P. ROY. 1974. Karyological studies in Cucumis (L.). Caryologia 27: 153-160.
CCDB · book-indian_vol1 — Singh, A.K. & Roy, R.P. 1974
CCDB · book-indian_vol1 — Janaki Ammal (D. 1945) ; Dane, F & Tsuchiya, T. 1976
CCDB · book-fedorov — J'anaki Ammal
CCDB · book-fedorov — D. 1945)
CCDB · book-atlas-flowering-plants — EKJ*
CCDB · kew — Ramachandran C, Narayan RKJ. 1985. Chromosomal DNA variation in Cucumis. Theoretical and Applied Genetics 69: 497-502.
n 1217×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · Cave1963
CCDB · ipcn-api-dl — Sidhu, M. K. 1979. Distributional and cytological studies of the weed flora of cultivable fields of Patiala district (Panjab). Ph.D. Thesis, Patiala. 1-230. 1979.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1979. Cytological observations in weed fiora of orchards of Paticla district, Punjab. Recent Res. Pl. Sci. (New Delhi). 7: 261–271.
CCDB · ipcn-api-dl — Beevy, S. S. & P. Kuriachan. 1996. Chromosome numbers of south Indian Cucurbitaceae and a note on the cytological evolution in the family. J. Cytol. Genet. 31(1): 65–71.
CCDB · ipcn-api-dl — Sanjappa, M. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 274–275.
CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1975. Weed flora of cultivable lands in Punjab maize fields in Patiala district. Acta Bot. Indica 3: 136–141.
CCDB · ipcn-api-dl — Ayyangar, K. R. 1983. On the meiotic disparity between two cultivars of Cucumis melo Linn. Proc. Indian Sci. Congr. Assoc. 70(3–VI): 79.
CCDB · ipcn-api-dl — Yadava, K. S., A. K. Singh & H. C. Arya. 1984. Cytogenetic investigation in Cucumis L. I. Meiotic analysis in twenty- four Cucumis species. Cytologia 49: 1–9.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · book-ipcn73-74 — BI.R, S.S., I M. SIDHU. 197 4. In IOPB chromosome number reports XLIV. Taxon 23: 373-380.
CCDB · Cave1963 — Vasil 1962
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelComplete Genome
Completeness97% BUSCO
07Deep time0.01–0 Ma
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
Fossil range0.01–0 Ma Pleistocene, Holocene
Dated fossil finds1
StatusStill living record runs to the present
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The solid bar is the fossil range: the span between the oldest and the youngest fossil that palaeontologists have assigned to Cucumis melo. Above itBeside it, each dot is one dated fossil find — few enough to count, so they are drawn individually rather than as a graph.
fossil range (PBDB)each dot = one dated find
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type13 417 records
Wild obs. + sensor6 970
Museum / vouchered3 144
Cultivated / captive1 534
Fossil1
Other1 768
Origin
Native586
Introduced96
Range
Area of Occupancy AOO25 964 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy81% within 1 km
≤100 m 3 201≤1 km 573≤10 km 695>10 km 213
4 682 georeferenced · 2 288 without coordinates
Open the mapobservation + sensor6 970
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy61% within 1 km
≤100 m 568≤1 km 206≤10 km 392>10 km 101
1 267 georeferenced · 1 877 without coordinates
Open the institutions mapphysical evidence3 144
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy5% within 1 km
≤1 km 3≤10 km 37>10 km 20
60 georeferenced · 1 474 without coordinates
Open the mapnot free-living1 534
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions129 of 238 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| ESP026location not on record | 707 |
| Brisbane, AU | 216 |
| Palmerston, AU | 172 |
| ESP027location not on record | 113 |
| Canberra, AU | 103 |
| Kensington, AU | 101 |
| Durango, MX | 80 |
| Saint Louis, US | 77 |
| ESP058location not on record | 75 |
| Museo Entomologico de Leonlocation not on record | 75 |
| SLU Artdatabankenlocation not on record | 59 |
| Adelaide, AU | 57 |
| Olocation not on record | 56 |
| Stadt Seeland, Ortsteil Gatersleben, DE | 51 |
| HUN003location not on record | 46 |
| Armidale, AU | 41 |
| Kew, GB | 38 |
| National Biodiversity Institute, Costa Ricalocation not on record | 32 |
| LDlocation not on record | 31 |
| Austin, US | 29 |
| Mérida, MX | 29 |
| Mount Annan, AU | 29 |
| Allentown, US | 26 |
| Paris, FR | 22 |
| Beijing, CN | 19 |
| Yangling, CN | 19 |
| UChlocation not on record | 18 |
| Smithfield, AU | 17 |
| Tampa, US | 16 |
| Puerto Ayora, EC | 16 |
| Universidad de Antioquia (UdeA)location not on record | 16 |
| BIO-UNIPIlocation not on record | 15 |
| ESP198location not on record | 15 |
| Mexico City, MX | 13 |
| Chapingo, MX | 12 |
| Xiamen, CN | 12 |
| Texas Lutheran Universitylocation not on record | 12 |
| Miami, US | 12 |
| MeiseBGlocation not on record | 11 |
| Tapachula, MX | 11 |
| Nanjing, CN | 11 |
| Podgorica, ME | 11 |
| Forest Herbarium Ibadan (FHI)location not on record | 11 |
| Culiacán, MX | 11 |
| University of Stellenboschlocation not on record | 9 |
| CJBGlocation not on record | 9 |
| Helsinki, FI | 9 |
| Mexico City, MX | 9 |
| Oskarshamn, SE | 8 |
| León, NI | 8 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 8 |
| Yaoundé, CM | 8 |
| DBF-NHMDlocation not on record | 7 |
| Santa Barbara, US | 7 |
| Jena Microbial Resource Collectionlocation not on record | 7 |
| Antiguo Cuscatlán, SV | 7 |
| Oulu, FI | 7 |
| Université du Lomélocation not on record | 7 |
| TAIElocation not on record | 7 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 6 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 6 |
| Guangzhou, CN | 6 |
| Zapopan, MX | 6 |
| Bern, CH | 6 |
| South Kensington, GB | 6 |
| HNBlocation not on record | 6 |
| ASUlocation not on record | 6 |
| Bronx, US | 5 |
| Chicago, US | 5 |
| Tartu, EE | 5 |
| Fort Worth, US | 5 |
| Riverside, US | 5 |
| Montecillo, Texcoco, MX | 5 |
| National Institute of Biological Resourceslocation not on record | 4 |
| Universidad Industrial de Santander (UIS)location not on record | 4 |
| UFERSAlocation not on record | 4 |
| ROM007location not on record | 4 |
| Mérida, MX | 4 |
| Fayetteville, US | 4 |
| Vancouver, CA | 4 |
| Rishon Le Zion, IL | 4 |
| Uppsala, SE | 4 |
| Wuhan, CN | 4 |
| Wuzhou, CN | 4 |
| Madison, US | 4 |
| Stockholm, SE | 4 |
| Taipei, TW | 4 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 4 |
| Nanjing, CN | 4 |
| John T. Waterhouse Herbariumlocation not on record | 4 |
| Hobart, AU | 4 |
| San José, CR | 3 |
| Tuxtla Gutiérrez, MX | 3 |
| ISAlocation not on record | 3 |
| San Francisco de Campeche, MX | 3 |
| Little Rock, US | 3 |
| US | 3 |
| Provincia di Livornolocation not on record | 3 |
| Philadelphia, US | 3 |
| CICYTEXlocation not on record | 3 |
| Brussel, BE | 3 |
| Berlin, DE | 3 |
| ROM019location not on record | 3 |
| Phyletisches Museum Jenalocation not on record | 3 |
| Plocation not on record | 3 |
| BGPAlocation not on record | 3 |
| Chongqing Museumlocation not on record | 3 |
| Claremont, US | 3 |
| Universidad de Caldas (UCaldas)location not on record | 3 |
| Lanzhou, CN | 3 |
| ifplocation not on record | 3 |
| Altos de Pipe, VE | 3 |
| Karlsruhe, DE | 3 |
| GMBAlocation not on record | 3 |
| Juriquilla, MX | 3 |
| Phoenix, US | 2 |
| Tlalnepantla, MX | 2 |
| Logan, US | 2 |
| MAlocation not on record | 2 |
| Kunming, CN | 2 |
| Mlocation not on record | 2 |
| Guilin, CN | 2 |
| Denver, US | 2 |
| Fortaleza, BR | 2 |
| Emporia, US | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 2 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 2 |
| Chaguaramas, TT | 2 |
| Hermosillo, MX | 2 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| Universidad Nacional de Colombia (UNAL)location not on record | 2 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 2 |
| Tuscaloosa, US | 2 |
| Córdoba, AR | 2 |
| LfUlocation not on record | 2 |
| Jackson, US | 2 |
| POL003location not on record | 2 |
| USP-IBlocation not on record | 2 |
| James Cook Townsvillelocation not on record | 2 |
| Barcelona, ES | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| San Diego, US | 2 |
| Hangzhou, CN | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| Dekalb, US | 2 |
| Ciudad de México, MX | 2 |
| Frankfurt am Main | 2 |
| Nijmegen, NL | 1 |
| València, ES | 1 |
| Durham, US | 1 |
| Christchurch, NZ | 1 |
| Clemson, US | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Auckland, NZ | 1 |
| HUAlocation not on record | 1 |
| Wlocation not on record | 1 |
| Kuopio, FI | 1 |
| Pullman, US | 1 |
| UNIVASFlocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Montréal, CA | 1 |
| Chapel Hill, US | 1 |
| Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record | 1 |
| San Isidro, AR | 1 |
| Sri Ramaswamy Memorial Universitylocation not on record | 1 |
| Tamil Nadu Agricultural Universitylocation not on record | 1 |
| BDBClocation not on record | 1 |
| JBSlocation not on record | 1 |
| Moscow State Universitylocation not on record | 1 |
| Conservatoire Botanique National de Mascarinlocation not on record | 1 |
| Durham, US | 1 |
| Alicante, ES | 1 |
| Pennsylvania Department of Agriculturelocation not on record | 1 |
| Royal Alberta Museumlocation not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 1 |
| Shenzhen, CN | 1 |
| Millersville, US | 1 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 1 |
| South China Normal Universitylocation not on record | 1 |
| Department of Botany Herbarium Ahmadu Bello University, Zarialocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Managua, NI | 1 |
| Glocation not on record | 1 |
| Xining, CN | 1 |
| CEPLAClocation not on record | 1 |
| Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| Guatemala City, GT | 1 |
| Universidad del Quindío (UniQuindío)location not on record | 1 |
| Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record | 1 |
| INBIOlocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Aarhus, DK | 1 |
| COLlocation not on record | 1 |
| Leiden University Medical Centerlocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 1 |
| Bourges, FR | 1 |
| Mazatlán, MX | 1 |
| Shanghai, CN | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Jishou Universitylocation not on record | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Coimbra, PT | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| Knoxville, US | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| Department of Botany, GC University, Lahorelocation not on record | 1 |
| ARM059location not on record | 1 |
| PUC-RSlocation not on record | 1 |
| Pondicherry, IN | 1 |
| NMBU:MINAlocation not on record | 1 |
| Torreón, MX | 1 |
| EL PASO, US | 1 |
| KMNlocation not on record | 1 |
| UEPAlocation not on record | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
| Changsha, CN | 1 |
| College Park, US | 1 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| La Paz, BO | 1 |
| Jyväskylä, FI | 1 |
| BFLlocation not on record | 1 |
| Bangkok, TH | 1 |
| Mississippi State, US | 1 |
| St. Paul, US | 1 |
| Boise, US | 1 |
| St. Augustine, TT | 1 |
| Honolulu, US | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| AZE015location not on record | 1 |
| Williamsburg, US | 1 |
238 institutions · 3 038 of 3 144 vouchered records shown · 103 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA55 detections
Where the DNA of Cucumis melo was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found55
Studies independent surveys2
Countries13
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 55 detections have coordinates
Open the map13 countries0
Side of pondCultivated habitat
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median24.3 °C 9.70–28.1
Seasonal swing summer↔winter15.3 °C
Max temp (day)30.7 °C 14.8–33.2
Min temp (night)18.4 °C 3.70–23.2
Precipitation70.4 mm/mo 14.3–112
Air humidity56.0 % 45.5–58.7
Moisture balance-45.3 mm/mo -140–-22.4
Vapour deficit1,514 Pa 597–1,769
Wind speed2.90 m/s 1.80–4.40
Cloud cover21.6 % 10.0–41.2
CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.