Cucumis maderaspatanus

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Cucurbitales/Cucurbitaceae/Cucumis

At a glance

Occurrence records1 277

Data sources9

Biological traits23

DNA specimens25

eDNA detections19

Sources9 archives

Databases and archives Cucumis maderaspatanus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 277 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF1 277 records

Environmental DNA1 datasets · 11 countries19 detections

DNA & barcodingBOLD · NCBI25 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Mukia maderaspatana is a species of plant in the family Cucurbitaceae. The species is found throughout Indomalaya and Meganesia. It is also known as Cucumis maderaspatanus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height2 m

Plant height max1 m

Plant height min0 m

Seed mass9.08 mg

⚠ sources differ — TRY: 9.08 mg · GIFT: 9.83 mg

Seed mass max14.19 mg

Seed mass min4.91 mg

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typeanimal

Life formclimbing annual

Life spanperennial

⚠ sources differ — TRY: perennial · GIFT: annual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberobligatory

Elevation max1 800 m

Elevation min45 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Climber

Woodinessnon-woody

Physiology & chemistry3

Leaf dry-matter content (LDMC)349 mg/g

Nitrogen fixingnon_nitrogen_fixer

Specific leaf area (SLA)18.9 mm²/mg

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cucumis maderaspatanus has left across the world's sequence archives.

At a glance

DNA specimens25

Marker genes7

GenBank sequences10

eDNA detections19

Countries11

The DNA barcodea real sequence read deposited for this species

ITSLN896362.2 ↗276 bpThailand

ACGT

TTCGTAGGTGACCTGCGGAGGATCATTGTCGATGCCTAAACGTCAAACGACCCGCGAACGCGTTCACGAACAAACCGTCCGGGGCGGGGT …

Cucumis maderaspatanus genomic DNA sequence contains ITS1, specimen voucher P. Phonsena et al. 3909 (L)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★rbcLa★trnL-F★ITS4★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Cucumis maderaspatanus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Chromosome records22–242n range24median24mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 244×CCDB · ipcn-api-dl · CCDB · book-indian_vol1

CCDB · ipcn-api-dl — Sharma, S. K. & S. Saran. 1992. Cytological study in Melothria spp. Proc. Indian Sci. Congr. Assoc. 79(3:VIII): 134–135.

CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1975. Weed flora of cultivable lands in Punjab maize fields in Patiala district. Acta Bot. Indica 3: 136–141.

CCDB · book-indian_vol1 — Baquar, S.R. & Husain, S.A. 1967

CCDB · book-indian_vol1 — Sarkar, A.K. et al. 1974 ; Singh, A.K. 1974b l ; India.

2n 221×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Bir, S.S. & Sidhu, M. 1980 1951

n 125×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74

CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1980. Cyto-palynological studies on weed flora of cultivable lands of Patiala district (Punjab). J. Palynol. 16: 85–105.

CCDB · ipcn-api-dl — Beevy, S. S. & P. Kuriachan. 1996. Chromosome numbers of south Indian Cucurbitaceae and a note on the cytological evolution in the family. J. Cytol. Genet. 31(1): 65–71.

CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.

CCDB · book-ipcn67-71 — BAQUAR, S.R., & S.A. HUSAIN. 1967. Chromosome studies in some flowering plants of West Pakistan. I. Phyton (BA) 24: 49-55.

CCDB · book-ipcn73-74 — SARKAR, A.K., R. DATTA, & M. RAYCHOWDHURY. 1974. In IOPB chromosome number reports XLVI. Taxon 23: 801-812.

n 112×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1975. Weed flora of cultivable lands in Punjab maize fields in Patiala district. Acta Bot. Indica 3: 136–141.

CCDB · ipcn-api-dl — Bir, S. S. & M. Sidhu. 1979. Cytological observations in weed fiora of orchards of Paticla district, Punjab. Recent Res. Pl. Sci. (New Delhi). 7: 261–271.

08Occurrence & distribution

Record type1 277 records

Wild obs. + sensor751

Museum / vouchered230

Other296

Range

Area of Occupancy AOO3 816 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 213≤1 km 95≤10 km 44>10 km 20

372 georeferenced · 379 without coordinates

Open the mapobservation + sensor751

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy37% within 1 km

≤1 km 32≤10 km 38>10 km 16

86 georeferenced · 144 without coordinates

Open the institutions mapphysical evidence230

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	68
Saint Louis, US	18
WAGlocation not on record	16
Kew, GB	15
Université National du Béninlocation not on record	10
Stadt Seeland, Ortsteil Gatersleben, DE	9
Museo Entomologico de Leonlocation not on record	9
LBVlocation not on record	6
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	6
Hobart, AU	5
Frankfurt am Main	4
University of Stellenboschlocation not on record	4
Wlocation not on record	3
Canberra, AU	2
Brisbane, AU	2
Durban, ZA	2
Instituto de Investigação Científica Tropicallocation not on record	2
Mlocation not on record	2
Haramaya Universitylocation not on record	2
Bronx, US	2
Gujarat Biodiversity Gene Banklocation not on record	2
MAlocation not on record	1
Plocation not on record	1
Clocation not on record	1
Provincia di Livornolocation not on record	1
IPA/SPlocation not on record	1
Moscow State Universitylocation not on record	1
CIRADlocation not on record	1
Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record	1
Paris, FR	1
MeiseBGlocation not on record	1
Philadelphia, US	1
Pretoria, ZA	1
BRLUlocation not on record	1
Addis Ababa, ET	1
Pennsylvania Department of Agriculturelocation not on record	1
Herbier National du Gabonlocation not on record	1
Elocation not on record	1
University of Johannesburglocation not on record	1
Claremont, US	1

40 institutions · 208 of 230 vouchered records shown · 14 without an institution code

09Environmental DNA19 detections

Where the DNA of Cucumis maderaspatanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries11

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map11 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 21.0–28.4

Seasonal swing summer↔winter7.20 °C

Max temp (day)30.6 °C 26.6–34.4

Min temp (night)21.5 °C 15.0–23.4

Precipitation96.3 mm/mo 10.9–249

Air humidity56.6 % 46.8–63.4

Moisture balance-62.6 mm/mo -122–150

Vapour deficit1,496 Pa 1,082–1,962

Wind speed2.70 m/s 1.70–5.20

Cloud cover24.2 % 11.2–41.5

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cucumis maderaspatanus

At a glance

Sources9 archives

Size & morphology6

Life cycle & reproduction5

Diet & foraging1

Habitat & environment8

Physiology & chemistry3

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 277 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 40 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 277 records