Cryptolaemus montrouzieri

Mulsant, 1853 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Coccinellidae/Cryptolaemus

At a glance

Occurrence records4 141

Data sources12

Biological traits0

DNA specimens64

eDNA detections70

Sources12 archives

Databases and archives Cryptolaemus montrouzieri's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 141 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI70 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics64 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF4 141 records

Environmental DNA3 datasets · 8 countries70 detections

DNA & barcodingBOLD64 specimens

Genome at a glanceGoaT · TreeOfSex · NCBI782 Mbp

01Narrative

Cryptolaemus montrouzieri, common name mealybug ladybird or mealybug destroyer, is a ladybird species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition2 compounds

Compounds documented for Cryptolaemus montrouzieri across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Piperidine alkaloids1

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
1-[(2S,6S)-6-methylpiperidin-2-yl]propan-2-one		present	LOTUS
Euphococcinine		present	LOTUS

05DNA & barcoding64 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cryptolaemus montrouzieri has left across the world's sequence archives.

At a glance

DNA specimens64

BINs2

Marker genes3

eDNA detections70

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P624 bp consensus54 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

18Gvariable

45Gvariable

78Tvariable

282Gvariable

288Avariable

303Tvariable

309Avariable

339Gvariable

405Tmostly conserved

477Gvariable

492Avariable

528Tvariable

591Cvariable

600Cmostly conserved

ATAATTGGAACTTCTTTGAGAATATTAATTCGTCTTGAATTAGGGACACCTAGAGCTTTAATTGGAAATGATCAAATTTATAATGTTATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes4

BINs2

Most divergent pair1.9%

AfricaAsiaOceaniaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Brachiacantha ursinasame family15.1%Onthophagus ensifersame order15.5%Lichenaula onychodessame order15.7%Tumicla smithisame order15.9%Lascoria niveasame order16.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P16S

animal barcoderibosomal

06Genome at a glanceGoaT · TreeOfSex · NCBI

The complete instruction manual Cryptolaemus montrouzieri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size782 400 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Cryptolaemus montrouzieri0.78 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records22–222n range22median22mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 225×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

TreeOfSex · invert — Smith SG, Virkki N (1978) Animal Cytogenetics Vol. 3 Insecta 5 Coleoptera. Berlin: Gebruder Borntraeger. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness98.4% BUSCO

08Occurrence & distribution

Record type4 141 records

Wild obs. + sensor3 695

Museum / vouchered446

Origin

Native17

Range

Area of Occupancy AOO10 276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 1 673≤1 km 512≤10 km 185>10 km 333

2 703 georeferenced · 992 without coordinates

Open the mapobservation + sensor3 695

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 25≤1 km 10≤10 km 74>10 km 4

113 georeferenced · 333 without coordinates

Open the institutions mapphysical evidence446

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	119
Sydney, AU	59
Museums Victorialocation not on record	48
Santa Barbara Museum of Natural Historylocation not on record	33
Natick, US	30
Auckland, NZ	29
OSUClocation not on record	25
Tasmanian Museum & Art Gallerylocation not on record	10
Taiwan Forestry Research Institutelocation not on record	8
The University of Hawaii Insect Museumlocation not on record	8
University of Alberta Museums (UAM)location not on record	7
Helsinki, FI	7
New Haven, US	7
Cape Town, ZA	6
Paris, FR	6
SLU Artdatabankenlocation not on record	6
Los Angeles, US	5
US	4
CUlocation not on record	3
Universidad Católica de Manizaleslocation not on record	3
Natural History Museum of Los Angeles County, Entomology Sectionlocation not on record	2
US	2
Natural History Museum Rotterdamlocation not on record	2
Nijmegen, NL	2
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	1
Brussel, BE	1
Kerala Agricultural Universitylocation not on record	1
CTNIlocation not on record	1
UFPRlocation not on record	1
South African National Biodiversity Institutelocation not on record	1
NTNU-VMlocation not on record	1
KwaZulu-Natal Museumlocation not on record	1
VBUlocation not on record	1
University Park, US	1
Itami Shi, JP	1

35 institutions · 442 of 446 vouchered records shown · 4 without an institution code

09Environmental DNA70 detections

Where the DNA of Cryptolaemus montrouzieri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found70

Studies independent surveys3

Countries8

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 70 detections have coordinates

Open the map8 countries0

UnknownUrbanTransformedForestSuburbanOpen forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 16.4–27.5

Seasonal swing summer↔winter7.90 °C

Max temp (day)27.7 °C 20.5–30.3

Min temp (night)20.4 °C 12.4–24.9

Precipitation109 mm/mo 25.7–290

Air humidity61.2 % 58.1–64.1

Moisture balance-23.7 mm/mo -91.5–129

Vapour deficit1,155 Pa 709–1,435

Wind speed2.80 m/s 1.60–4.60

Cloud cover35.3 % 25.1–58.3

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cryptolaemus montrouzieri

At a glance

Sources12 archives

Compound class profile1 class

Documented compounds2 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type4 141 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 141 records