Cryptococcus gattii

(Vanbreus. & Takashio) Kwon-Chung & Boekhout · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Tremellomycetes/Tremellales/Cryptococcaceae/Cryptococcus

At a glance

Occurrence records858

Data sources10

Biological traits0

DNA specimens647

eDNA detections312

Sources10 archives

Databases and archives Cryptococcus gattii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility858 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI312 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics647 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF858 records

Environmental DNA3 datasets · 26 countries312 detections

DNA & barcodingBOLD · NCBI647 specimens

Genome at a glanceGoaT · NCBI17 Mbp

01Narrative

Cryptococcus gattii oder Cryptococcus neoformans var. gattii ist ein infektiöser Hefepilz, der vornehmlich in tropischen und subtropischen Klimaten vorkommt. Er ist ein Erreger der Kryptokokkose, einer opportunistischen Infektion. Während eine durch Cryptococcus neoformans verursachte Kryptokokkose fast ausschließlich bei Patienten mit massiver Immunschwäche auftritt, vermag Cryptococcus gattii auch bei Menschen mit einem intakten Immunsystem die Erkrankung auszulösen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding647 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cryptococcus gattii has left across the world's sequence archives.

At a glance

DNA specimens647

Marker genes6

GenBank sequences9

eDNA detections312

Countries26

The DNA barcodea real sequence read deposited for this species

ITSPV029213.1 ↗443 bpUSA · 2018

ACGT

TTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCTTATTATA …

Cryptococcus gattii isolate M9317 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS9★ITS1★ITS228S-D1-D25-8S

animal barcodefungal barcodemarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Cryptococcus gattii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size17 480 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Cryptococcus gattii0.02 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

Completeness93.4% BUSCO

08Occurrence & distribution

Record type858 records

Museum / vouchered844

Cultivated / captive14

Range

Area of Occupancy AOO740 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 844 records without

Open the institutions mapphysical evidence844

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the mapnot free-living14

10Collections & institutions

Institution	Specimens
Sydney Medical Schoollocation not on record	136
Universidad de Santander (UDES)location not on record	1
Queen Elizabeth II Medical Centrelocation not on record	1

3 institutions · 138 of 844 vouchered records shown · 692 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA312 detections

Where the DNA of Cryptococcus gattii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found312

Studies independent surveys3

Countries26

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 312 detections have coordinates

Open the map26 countries0

humanearth, animalplantyeast

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature16.6 °C 12.0–20.2

pH5.60 4.00–8.80

Conductivity74.2 µS/cm 14.0–11,700

Organic carbon3.12 % 0.006–5.66

Water content19.7 % 0.816–66.7

Nitrate-N9.00 mg/kg 1.00–209

Phosphorus14.0 mg/kg 2.00–182

Clay14.2 % 0.91–55.3

Sand70.7 % 16.4–98.0

Depth0 m 0–0.2

SoilDermosolTenosolsFerrosolSodosolKandosolOrganosol

87 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 10.7–26.0

Seasonal swing summer↔winter11.6 °C

Max temp (day)20.7 °C 16.3–29.9

Min temp (night)11.2 °C 6.20–22.6

Precipitation79.6 mm/mo 30.2–145

Air humidity59.2 % 52.9–64.6

Moisture balance-24.8 mm/mo -80.2–73.9

Vapour deficit844 Pa 524–1,484

Wind speed2.60 m/s 1.70–4.60

Cloud cover27.0 % 14.3–47.6

CHELSA 1981–2010, ~9 km grid, at location & month of 246 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)