Cryptocarya floydii

Kosterm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Laurales/Lauraceae/Cryptocarya

At a glance

Occurrence records137

Data sources8

Biological traits28

DNA specimens6

eDNA detections2

Sources8 archives

Databases and archives Cryptocarya floydii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility137 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources28 traits

Occurrence & distributionGBIF137 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Cryptocarya floydii is an Australian rainforest tree. It occurs in steep dry rocky gullies in northern New South Wales and adjacent areas in Queensland as far north as Bunya Mountains National Park. It grows as far south as the upper gullies of the Guy Fawkes River and the Macleay River. The common name is gorge laurel or Glenugie laurel, after the type locality of Glenugie Peak, near Grafton, New South Wales. This laurel is considered rare, with a ROTAP rating of 3RCi. It is named after the eminent rainforest botanist Alexander Floyd.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology12

Fruit length12 mm

Fruit width12 mm

Leaf length51 mm

Leaf length max110 mm

Leaf length min30 mm

Leaf width16 mm

Leaf width max35 mm

Leaf width min10 mm

Petiole length0.8 cm

Plant height15 m

Seed length8.5 mm

Seed width7 mm

Life cycle & reproduction4

Flowering timeyynnnnnnnyyy

Life formtree

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Leaf compoundnesssimple

Leaf shapelanceolate

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cryptocarya floydii has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKM896015.1 ↗514 bpAustralia

ACGT

GACTTATTATACTCCTGACTATGAAACCAAAAGTACTGATATTTTGGCAGCATTTCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAGGA …

Cryptocarya floydii voucher 1076418811 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type137 records

Wild obs. + sensor24

Museum / vouchered112

Other1

Origin

Native29

Range

Area of Occupancy AOO196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 20≤10 km 3

23 georeferenced · 1 without coordinates

Open the mapobservation + sensor24

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy62% within 1 km

≤100 m 22≤1 km 36≤10 km 34>10 km 2

94 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence112

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	29
Brisbane, AU	28
NSW Dept of Planning, Industry and Environmentlocation not on record	21
Armidale, AU	9
Canberra, AU	7
Smithfield, AU	7
Museo Entomologico de Leonlocation not on record	6
Brisbane Botanic Gardens, Queensland Herbariumlocation not on record	2
Hobart, AU	1

9 institutions · 110 of 112 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Cryptocarya floydii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.0 °C 16.0–16.0

Seasonal swing summer↔winter11.9 °C

Max temp (day)21.5 °C

Min temp (night)11.1 °C

Precipitation67.7 mm/mo

Air humidity58.5 %

Moisture balance-38.4 mm/mo

Vapour deficit773 Pa

Wind speed3.00 m/s

Cloud cover22.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)