Cryptocarya densiflora

Blume · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Laurales/Lauraceae/Cryptocarya

At a glance

Occurrence records702

Data sources12

Biological traits51

DNA specimens21

eDNA detections12

Sources12 archives

Databases and archives Cryptocarya densiflora's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility702 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources51 traits

Chemical compositionLOTUS · NPASS21 compounds

Occurrence & distributionGBIF702 records

Environmental DNA1 datasets · 4 countries12 detections

DNA & barcodingBOLD · NCBI21 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Cryptocarya densiflora Blume – gatunek rośliny z rodziny wawrzynowatych. Występuje naturalnie w Laosie, Wietnamie, Malezji, Indonezji, na Filipinach oraz w południowych Chinach.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology22

Fruit length12.5 mm

⚠ sources differ — AusTraits: 12.5 mm · GIFT: 14.75 mm

Fruit length max18 mm

Fruit length min12 mm

Fruit width16.25 mm

⚠ sources differ — AusTraits: 16.25 mm · GIFT: 19.05 mm

Fruit width max25 mm

Fruit width min15 mm

Inflorescence length max8 cm

Inflorescence length min2.5 cm

Leaf length70 mm

⚠ sources differ — AusTraits: 70 mm · GIFT: 125 mm

Leaf length max150 mm

Leaf length min100 mm

Leaf mass per area140 g/m2

Leaf size8 245 mm²

⚠ sources differ — TRY: 8 245 mm² · AusTraits: 3 480 mm²

Leaf width60 mm

Leaf width max85 mm

Leaf width min50 mm

Petiole length1.15 cm

Plant height13.25 m

⚠ sources differ — GIFT: 13.25 m · AusTraits: 30 m · TRY: 20 m

Plant height max20 m

Plant height min7 m

Seed length8.5 mm

Seed width13 mm

Life cycle & reproduction8

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Flowering timeynnnnnnnnyyy

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment13

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max1 600 m

Elevation mean1 125 m

Elevation min650 m

Epiphyteterrestrial

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate

Woodinesswoody

Physiology & chemistry6

Leaf n15.77 mg/g

Leaf p1.22 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)5.48 mm²/mg

Wood density536 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition21 compounds

Compounds documented for Cryptocarya densiflora across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Germacrane sesquiterpenoids3

Isoflavones3

Aporphine alkaloids $ Isoquinoline alkaloids3

Aporphine alkaloids2

Isoquinoline alkaloids2

Documented compounds21 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-N-Methylisococlaurine	present	NPASS
(-)-Galantamine	present	NPASS
(-)-Maackiain	present	NPASS
(12aS)-3,9,10-trimethoxy-7-methyl-5,6,12,12a-tetrahydroindolo[2,1-a]isoquinolin-7-ium-2-ol	present	LOTUS
(12S)-18,19-dimethoxy-5,7-dioxa-13-azapentacyclo[10.7.1.02,10.04,8.016,20]icosa-1(20),2,4(8),9,16,18-hexaene	present	NPASS
(1S,4S,6S,13S,14S)-6,11-dimethyl-5,9,15,17-tetraoxapentacyclo[11.2.2.01,14.04,6.08,12]heptadeca-8(12),10-dien-16-one	present	LOTUS
(3Z)-5,10-dimethyl-8,14,16-trioxatetracyclo[10.2.2.01,13.07,11]hexadeca-3,7(11),9-trien-15-one	present	LOTUS
(8R)-3-(6-methoxy-1,3-benzodioxol-5-yl)-8-prop-1-en-2-yl-8,9-dihydrofuro[2,3-h]chromen-4-one	present	NPASS
10-Methoxyspiro[5-azatricyclo[6.3.1.04,12]dodeca-1(12),8,10-triene-2,4'-cyclohexane]-1',11-diol	present	NPASS
3,4-Dimethoxy-N,N-dimethyl-1-phenanthreneethanamine	present	NPASS

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cryptocarya densiflora has left across the world's sequence archives.

At a glance

DNA specimens21

Marker genes5

GenBank sequences10

eDNA detections12

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPQ589620.1 ↗486 bpPapua New Guinea

ACGT

GACAACAACAGGGCGCAGCGCGCGCCAAGCACTTGAAGCGAATAGGTTGGGCCCCTCGCCCGTTGCCTCGCCCCTTGCAGTGGGGGCACG …

Cryptocarya densiflora voucher Munzinger6975 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★ITS7trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Cryptocarya densiflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 241×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Oginuma. 2006. Chromosome evolution in the Laurales based on analyses of original and published data. J. Pl. Res. 119: 309–320.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type702 records

Wild obs. + sensor5

Museum / vouchered654

Cultivated / captive2

Other41

Origin

Native10

Range

Area of Occupancy AOO1 180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤100 m 32≤1 km 20≤10 km 111>10 km 19

182 georeferenced · 472 without coordinates

Open the institutions mapphysical evidence654

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions32 of 44 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	134
Brisbane, AU	80
Paris, FR	38
Guangzhou, CN	25
Kunming, CN	20
Museo Entomologico de Leonlocation not on record	17
Canberra, AU	15
Kew, GB	13
Guilin, CN	13
Beijing, CN	12
Mount Annan, AU	10
James Cook Townsvillelocation not on record	8
St. Paul, US	7
Bronx, US	7
Chengdu, CN	6
Honolulu, US	4
Australian Tropical Herbariumlocation not on record	4
Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record	3
Edinburgh, GB	3
Palmerston, AU	3
Nanjing, CN	3
Cibinong Science Center, Herbarium Bogorienselocation not on record	3
Central China Normal Universitylocation not on record	3
Saint Louis, US	2
University of the Sunshine Coastlocation not on record	2
Yunnan Universitylocation not on record	2
Nanjing, CN	2
Parkville, AU	2
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	2
Changsha, CN	2
Guiyang, CN	2
South Kensington, GB	1
Seoul, KR	1
Taipei, TW	1
University of Stellenboschlocation not on record	1
Armidale, AU	1
Nanjing, CN	1
Cambridge, US	1
Monastir, TN	1
Hangzhou, CN	1
ASUlocation not on record	1
Southwest Forestry Collegelocation not on record	1
Wuhan, CN	1
Fort Worth, US	1

44 institutions · 460 of 654 vouchered records shown · 188 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA12 detections

Where the DNA of Cryptocarya densiflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.4 °C 12.2–22.8

Seasonal swing summer↔winter7.80 °C

Max temp (day)24.8 °C 18.5–26.4

Min temp (night)17.7 °C 5.80–20.6

Precipitation279 mm/mo 10.3–380

Air humidity68.3 % 48.9–72.6

Moisture balance127 mm/mo -66.0–248

Vapour deficit739 Pa 693–836

Wind speed3.10 m/s 1.80–3.40

Cloud cover48.0 % 8.80–62.4

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)