Cryptocarya corrugata

C.T.White & Francis · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Laurales/Lauraceae/Cryptocarya

At a glance

Occurrence records455

Data sources8

Biological traits35

DNA specimens12

eDNA detections6

Sources8 archives

Databases and archives Cryptocarya corrugata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility455 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Occurrence & distributionGBIF455 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI12 specimens

01Narrative

Cryptocarya corrugata is a species of tree in the family Lauraceae. Found in tropical rainforest in Queensland in Australia, this species may grow to 35 metres tall. Collected by William Francis west of Mackay in the Eungella range in 1922. The fruit is eaten by cassowaries and fruit pigeons.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraitsTRY

Size & morphology17

Fruit length18.5 mm

Fruit width28 mm

Leaf length35 mm

Leaf mass135 mg

Leaf mass per area70.53 g/m2

Leaf size1 785 mm²

Leaf width37.5 mm

Petiole length1.2 cm

Plant height28 m

⚠ sources differ — GIFT: 28 m · AusTraits: 40 m

Seed length19 mm

Seed mass2 279 mg

⚠ sources differ — TRY: 2 279 mg · AusTraits: 2 400 mg · GIFT: 2 119 mg

Seed mass max2 800 mg

Seed mass min1 157 mg

Seed volume2 500 mm³

Seed volume max2 500 mm³

Seed volume min2 500 mm³

Seed width27.5 mm

Life cycle & reproduction7

Deciduousnessevergreen

Flowering timeynnnnnnnnnyy

Life formtree

Life spanperennial

Pollination syndromebeetle

Resprouting capacityfire_killed

Sex typehermaphrodite

Habitat & environment8

Climateseasonally dry tropical

Climberself-supporting

Fruit fleshinessfleshy

Fruit typedrupe

Growth formtree

Leaf compoundnesssimple

Leaf shapeelliptical ovate

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Wood density673 mg/cm³

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cryptocarya corrugata has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes4

GenBank sequences1

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

matKJN564083.1 ↗780 bpAustralia · 2009

ACGT

TTTATTGCTATTCTTTCTCTACGAGTATTGGAACTCAAATAGTCTCATTACTCCAAAAAAATCAATTTCCCCTTTTTCAAAAGAGAATCA …

Cryptocarya corrugata isolate G24 maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type455 records

Wild obs. + sensor3

Museum / vouchered388

Other64

Origin

Native15

Range

Area of Occupancy AOO672 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 2 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 33≤1 km 52≤10 km 96>10 km 39

220 georeferenced · 168 without coordinates

Open the institutions mapphysical evidence388

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	169
Brisbane, AU	101
Canberra, AU	24
Museo Entomologico de Leonlocation not on record	18
Mount Annan, AU	15
Kew, GB	9
Palmerston, AU	7
James Cook Townsvillelocation not on record	5
Saint Louis, US	3
Australian Tropical Herbariumlocation not on record	2
CSIRO, Tropical Forest Research Centrelocation not on record	1
John T. Waterhouse Herbariumlocation not on record	1
Parkville, AU	1
University of the Sunshine Coastlocation not on record	1
ASUlocation not on record	1

15 institutions · 358 of 388 vouchered records shown · 28 without an institution code

09Environmental DNA6 detections

Where the DNA of Cryptocarya corrugata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 12.2–21.9

Seasonal swing summer↔winter8.10 °C

Max temp (day)19.9 °C 18.5–25.0

Min temp (night)11.3 °C 5.80–18.7

Precipitation44.8 mm/mo 10.3–274

Air humidity62.0 % 48.9–70.0

Moisture balance-53.1 mm/mo -67.7–123

Vapour deficit731 Pa 664–790

Wind speed3.40 m/s 2.50–3.40

Cloud cover30.4 % 8.80–53.7

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)