Cryptandra arbutiflora

Fenzl · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Rhamnaceae/Cryptandra

At a glance

Occurrence records134

Data sources6

Biological traits26

DNA specimens0

eDNA detections1

Sources6 archives

Databases and archives Cryptandra arbutiflora's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility134 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Occurrence & distributionGBIF134 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

01Narrative

Cryptandra arbutiflora, commonly known as waxy cryptandra, is a shrub species in the family Rhamnaceae. It is endemic to the south-west of Western Australia, occurring between the south coast and the Dandaragan area to the north and also near Geraldton. It ranges from 0.05 to 1 metre in height and produces cream bell-shaped flowers between May and November. The species was first formally described by botanist Eduard Fenzl based on plant material collected by Charles von Hügel from the Swan River area. Fenzl's description was published in 1837 in Enumeratio plantarum quas in Novae Hollandiae ora austro-occidentali ad fluvium Cygnorum et in sinu Regis Georgii collegit Carolus Liber Baro de Hügel The Latin specific epithet arbutiflora alludes to the flowers which are reminiscent of those of Arbutus unedo, the Irish Strawberry Tree. Four varieties are currently recognised: C. arbutiflora Fenzl var. arbutiflora C. arbutiflora var. borealis Rye C. arbutiflora var. pygmaea Rye C. arbutiflora var. tubulosa (Fenzl) Benth. A former variety C. arbutiflora var. intermedia is now regarded as a species in its own right - Cryptandra intermedia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology8

Leaf length6 mm

Leaf width1.4 mm

Plant height1 m

Plant height max1 m

Plant height min0.05 m

Seed mass0.17 mg

⚠ sources differ — TRY: 0.17 mg · AusTraits: 0.46 mg · GIFT: 0.17 mg

Seed mass max0.17 mg

Seed mass min0.17 mg

Life cycle & reproduction5

Flowering timennnnyyyyyyyn

Life formsubshrub

Life spanperennial

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cryptandra arbutiflora has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSAY911546.1 ↗666 bp

ACGT

GAAGGATCATTGTCGAACCCTGCCTAGCAGAACGACCCGCGAACACGTATGAAAACATTTCGGGGGGCATGGGGCCTTAGTTAGGGGCCT …

Cryptandra arbutiflora var. borealis 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

07Deep time~10.4 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin10.4 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type134 records

Wild obs. + sensor89

Museum / vouchered45

Origin

Native17

Range

Area of Occupancy AOO392 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 51≤1 km 18≤10 km 2>10 km 2

73 georeferenced · 16 without coordinates

Open the mapobservation + sensor89

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 6≤1 km 5≤10 km 18>10 km 5

34 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence45

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mount Annan, AU	17
Kensington, AU	8
Canberra, AU	7
LDlocation not on record	4
BGPAlocation not on record	3
Brisbane, AU	1
Museo Entomologico de Leonlocation not on record	1
Kew, GB	1
Adelaide, AU	1
Smithfield, AU	1

10 institutions · 44 of 45 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Cryptandra arbutiflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)