Cryphonectria parasitica

(Murrill) M.E.Barr · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Diaporthales/Cryphonectriaceae/Cryphonectria

At a glance

Occurrence records28 888

Data sources11

Biological traits0

DNA specimens139

eDNA detections140

Sources11 archives

Databases and archives Cryphonectria parasitica's data was compiled from.

WikipediaWikimedia Foundation12 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility28 888 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI140 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics139 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS5 compounds

Occurrence & distributionGBIF28 888 records

Environmental DNA4 datasets · 14 countries140 detections

DNA & barcodingBOLD · NCBI139 specimens

Genome at a glanceGoaT · NCBI44 Mbp

01Narrative

The pathogenic fungus Cryphonectria parasitica (formerly Endothia parasitica) is a member of the Ascomycota (sac fungi). This necrotrophic fungus is native to East Asia and South East Asia and was introduced into Europe and North America in the early 1900s. The fungus spread rapidly and caused significant tree loss in both regions.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition5 compounds

Compounds documented for Cryphonectria parasitica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Phthalide derivatives2

Isocoumarins2

Flavanones1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Farrerol	present	NPASS
2-Hydroxy-2-(4-hydroxyphenyl)propanoic acid	present	LOTUS
8-Hydroxy-3-(2-hydroxypropyl)-6-methoxyisochromen-1-one	present	LOTUS
Cryphonectric Acid	present	LOTUS
DSEKYWAQQVUQTP-XOZNZPTHSA-N	present	NPASS

05DNA & barcoding139 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Cryphonectria parasitica has left across the world's sequence archives.

At a glance

DNA specimens139

Marker genes3

GenBank sequences10

eDNA detections140

Countries16

The DNA barcodea real sequence read deposited for this species

ITSMH857311.1 ↗487 bpItaly

ACGT

GCGAAGGCAGATTTTCTTCCTTCTCCCCTCCCTCCCCCCCCTCTTCCACCGTGCAAACGGTTGTTGGGGAGCAGGCCCGCCGGCGGCCCA …

Cryphonectria parasitica strain CBS 241.54 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10★ITS1

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Cryphonectria parasitica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size43 900 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Cryphonectria parasitica0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type28 888 records

Wild obs. + sensor28 689

Museum / vouchered199

Range

Area of Occupancy AOO10 608 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 581≤1 km 26 084≤10 km 53>10 km 58

26 776 georeferenced · 1 913 without coordinates

Open the mapobservation + sensor28 689

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 7≤1 km 21≤10 km 31>10 km 5

64 georeferenced · 135 without coordinates

Open the institutions mapphysical evidence199

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Sebastián, ES	13
Catholic University of Pekinglocation not on record	11
GJOlocation not on record	10
ILLSlocation not on record	9
Karlsruhe, DE	6
Bronx, US	4
Zürich, CH	4
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	4
Bernard Price Institute for Palaeontological Researchlocation not on record	4
Slovenian Forestry Institutelocation not on record	3
DPIlocation not on record	3
Chicago, US	2
TENN-Flocation not on record	2
FLASlocation not on record	2
WU-MYClocation not on record	2
UAclocation not on record	1
Davis and Elkins Collegelocation not on record	1
Bardejov, SK	1
Gijón, ES	1
McWane Science Centerlocation not on record	1
Helsinki, FI	1

21 institutions · 85 of 199 vouchered records shown · 11 without an institution code

09Environmental DNA140 detections

Where the DNA of Cryphonectria parasitica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found140

Studies independent surveys4

Countries14

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 140 detections have coordinates

Open the map14 countries0

Palearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.0 °C 5.90–15.4

Seasonal swing summer↔winter22.3 °C

Max temp (day)15.3 °C 9.60–18.5

Min temp (night)6.70 °C 1.10–10.4

Precipitation57.6 mm/mo 47.9–236

Air humidity60.7 % 57.3–65.9

Moisture balance-24.0 mm/mo -38.4–115

Vapour deficit629 Pa 370–789

Wind speed2.70 m/s 1.80–4.20

Cloud cover43.4 % 38.1–46.6

CHELSA 1981–2010, ~9 km grid, at location & month of 110 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Cryphonectria parasitica

At a glance

Sources11 archives

Compound class profile3 classes

Documented compounds5 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type28 888 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type28 888 records