Crustomyces subabruptus

(Bourdot & Galzin) Jülich · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Cystostereaceae/Crustomyces

At a glance

Occurrence records305

Data sources9

Biological traits0

DNA specimens3

eDNA detections7

Sources9 archives

Databases and archives Crustomyces subabruptus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility305 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF305 records

Environmental DNA3 datasets · 4 countries7 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Crustomyces subabruptus is a species of toothed crust fungus in the family Cystostereaceae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crustomyces subabruptus has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes1

GenBank sequences10

eDNA detections7

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPZ356660.1 ↗289 bpUSA · 1944

ACGT

GAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATTTCTCAACCTTTCTATTTTGTAATGAAATGTT …

Crustomyces subabruptus clone 3893 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type305 records

Wild obs. + sensor170

Museum / vouchered135

Origin

Native11

Range

Area of Occupancy AOO792 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy23% within 1 km

≤100 m 15≤1 km 15≤10 km 99>10 km 1

130 georeferenced · 40 without coordinates

Open the mapobservation + sensor170

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 13≤1 km 15≤10 km 22>10 km 1

51 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence135

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	24
Kew, GB	17
University of the Basque Country (UPV/EHU)location not on record	11
Mlocation not on record	6
UNINE:NEUlocation not on record	6
San Sebastián, ES	5
Chicago, US	5
GJOlocation not on record	4
HabitatVisionlocation not on record	4
MAlocation not on record	3
Tartu, EE	3
Philadelphia, US	3
WU-MYClocation not on record	3
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
California State University, East Baylocation not on record	2
Paris, FR	2
Auckland, NZ	2
Turku, FI	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	1
Royal Botanic Gardens, Kewlocation not on record	1
Copenhagen, DK	1
BRNUlocation not on record	1
Vancouver, CA	1
Helsinki, FI	1
DPIlocation not on record	1

26 institutions · 111 of 135 vouchered records shown · 24 without an institution code

09Environmental DNA7 detections

Where the DNA of Crustomyces subabruptus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys3

Countries4

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map4 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.70 5.60–5.80

Conductivity75.0 µS/cm 26.0–124

Organic carbon1.94 % 1.14–2.74

Nitrate-N33.0 mg/kg

Phosphorus13.0 mg/kg 2.00–24.0

Depth0 m

SoilKandosol

2 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.80 °C 5.90–18.6

Seasonal swing summer↔winter9.40 °C

Max temp (day)13.0 °C 7.90–21.2

Min temp (night)7.00 °C 3.60–16.3

Precipitation104 mm/mo 68.5–174

Air humidity64.0 % 60.6–66.7

Moisture balance33.6 mm/mo -50.5–112

Vapour deficit436 Pa 314–846

Wind speed4.70 m/s 2.90–5.30

Cloud cover51.7 % 25.6–60.3

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)