Crupina crupinastrum
(Moris) Vis. · speciesAt a glance
Occurrence records4 122
Data sources10
Biological traits25
DNA specimens22
eDNA detections6
Sources10 archives
Databases and archives Crupina crupinastrum's data was compiled from.
WikipediaWikimedia Foundation5 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 122 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics22 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources25 traits
Occurrence & distributionGBIF4 122 records
Environmental DNA1 datasets · 1 countries6 detections
DNA & barcodingBOLD · NCBI22 specimens
Genome at a glanceCCDB2n = 28
01Narrative
Crupina crupinastrum, also known as false saw wort, is a species of annual herb in the family Asteraceae. They have a self-supporting growth form and simple, broad leaves. Flowers are visited by scarce swallowtail, Hoplitis, Trichodes, and brimstone. Individuals can grow to 40 cm.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology7
Leaf size92.4 mm²
Plant height0.297 m
Plant height max0.8 m
Plant height min0.2 m
Seed mass13.24 mg
⚠ sources differ — TRY: 13.24 mg · GIFT: 14.16 mg
Seed mass max24.32 mg
Seed mass min4 mg
Life cycle & reproduction7
Dispersal type detailedanemochorous
Flowering endAug
Flowering startMay
Life formannual
Life spanannual
Lifespan years1 years
Raunkiær life formtherophyte
Diet & foraging1
Parasiteindependent
Habitat & environment7
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
Habitat GIFTstony places
Woodinessnon-woody
Physiology & chemistry3
Leaf dry-matter content (LDMC)219 mg/g
Leaf n23.45 mg/g
Specific leaf area (SLA)12.09 mm²/mg
05DNA & barcoding22 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crupina crupinastrum has left across the world's sequence archives.
At a glance
DNA specimens22
Marker genes5
GenBank sequences6
eDNA detections6
Countries4
The DNA barcodea real sequence read deposited for this species
ATCGCGTCGCCCCAGACCACGCTCCCACATGGGGATGTGTTTTGTTTGGGACGGATACTGGTCTCCCGTGCTGATGGTGCGGTTGGCTTA …
Crupina crupinastrum internal transcribed spacer 2, complete sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL1★ITS5★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Crupina crupinastrum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidydiploid inferred
Chromosome records18–362n range28median28mode48records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2841×CCDB · ita-fl · CCDB · iber-fl · CCDB · fl-europaea +6
CCDB · ita-fl — LARSEN K. - 1956. Chromosome studies in some Mediterranean and South European flowering plants.. Bot. Not. , 109(3): 293-307.
CCDB · ita-fl — PAVONE P., TERRASI M.C., ZIZZA A. - 1981. Chromosome number reports LXXII.. Taxon , 30(3): 695-696.
CCDB · ita-fl — COLOMBO P., MARCEN C., PRINCIOTTA R. - 1981 (1979). Numeri cromosomici per la flora italiana:662-675.. Inform. Bot. Ital. , 11(3): 315-324.
CCDB · ita-fl — SCRUGLI A., BOCCHIERI E. - 1976. NUmeri cromosomici per la flora italiana:263-269.. Inform. Bot. Ital. , 8(2): 216-223.
CCDB · iber-fl — Chromosomenzahlen aus der Tribus Cardueae (Compositae). Hellwig, H. Frank.Willdenowia24: 219-248(1994).
CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).
CCDB · iber-fl — Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Luque, T. & Z. Daz Lifante.Bocconea1: 303-364(1991).
CCDB · iber-fl — Studies on the flora of the Balearic Islands, I. Dahlgren, R., Th. Karlsson & P. Lassen.Bot. Not.124: 249-269(1971).
CCDB · fl-europaea — Larsen, 1956a
CCDB · mediterranean
CCDB · ipcn-api-dl — Couderc, M. 1975. Origine hybride du Crupina intermedia Briq. & Cavill. In La Flore du Bassin Méditerranéen. Colloques Internatl. C.N.R.S. 235: 531–536. C.N.R.S., Paris.
CCDB · ipcn-api-dl — Kuzmanov, B. A., S. B. Georgieva & V. A. Nikolova. 1986. Chromosome numbers of Bulgarian flowering plants. I. Fam. Asteraceae. Fitologija 31: 71–74.
CCDB · ipcn-api-dl — Luque, T. & Z. D. Lifante. 1991. Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303–364.
CCDB · ipcn-api-dl — Snogerup, S. 1995. Mediterranean chromosome number reports 5 (491--517). Fl. Medit. 5: 331–334.
CCDB · ipcn-api-dl — Baltisberger, M. 1993. Zytologische Untersuchungen an Compositen aus Albanien. Candollea 48(2): 437–448.
CCDB · ipcn-api-dl — Slavĭk, B., V. Jarolĭmovă & J. Chrtek. 1993. Chromosome counts of some plants from Cyprus. Candollea 48(1): 221–230.
CCDB · ipcn-api-dl — Hellwig, F. H. 1994. Chromosomenzahlen aus der Tribus Cardueae (Compositae). Willdenowia 24: 219–248.
CCDB · ipcn-api-dl — Vogt, R. & A. Aparicio. 1999. Chromosome numbers of plants collected during Iter Mediterraneum IV in Cyprus. Bocconea 11: 117–169.
CCDB · ipcn-api-dl — Pavone, P., C. M. Terrasi & A. Zizza. 1981. In Chromosome number reports LXXII. Taxon 30: 695–696.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Van Loon, J. C. 1980. In Chromosome number reports LXIX. Taxon 29: 718–720.
CCDB · ipcn-api-dl — Colombo, P., C. Marceno & R. Princiotta. 1979. Numeri cromosomici per la Flora Italiana: 662-675. Inform. Bot. Ital. 11: 315–323.
CCDB · ipcn-api-dl — Couderc, M. 1979. In IOPB chromosome number reports LXV. Taxon 28:632.
CCDB · ipcn-api-dl — Scrugli, A. & E. BOCCHIERI. 1976. Numeri cromosomici per la flora Italiana: 263-269. Inform. Bot. Ital. 8: 216–223.
CCDB · ipcn-api-dl — Kliphuis, E. & Y. I. Barkoudah. 1977. Chromosome numbers in some Syrian angiosperms. Acta Bot. Neerl. 26: 239–249.
CCDB · book-ipcn73-74 — DAHLGREN, R., TH. KARLSSON, & P. LASSEN. 1971. Studies on the flora I < the Balearic Islands. I. Chromosome numbers in Balearic angiosperms. sot. Notiser 124: 249~269.
CCDB · book-fedorov — MOAAY6HaH-ApHOllb~H 1931
CCDB · book-fedorov — Larsen 1956b
CCDB · book-atlas-flowering-plants — Poddubnaja 1931
CCDB · CromoCat 2015 — Vogt, R. & A. Aparicio. (1999). Chromosome numbers of plants collected during Iter Mediterraneum IV in Cyprus Bocconea, Monographiae Herbarii Mediterranei Panormitani 11: 117-169
CCDB · CromoCat 2015 — Colombo, P., Marcenó, C. & Princiotta, R. (1979a). Numeri cromosomici per la Flora Italiana: 662-675. Inf. Bot. Ital. 11: 315-323.
CCDB · CromoCat 2015 — Couderc, H. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXV]. Taxon 28(5/6): 632.
CCDB · CromoCat 2015 — Dahlgren, R., Karlsson, Th. & Lassen, P. (1971). Studies on the Flora of the Balearic Islands, I. Chromosome numbers in Balearic Angiosperms. Bot. Not. 124(1): 249-269.
CCDB · CromoCat 2015 — Kliphuis, E. & Barkoudah, Y. I. (1977). Chromosome numbers in some Syrian Angiosperms. Acta Bot. Neerl. 26: 239-249.
CCDB · CromoCat 2015 — Larsen, K. (1956a). Chromosome studies in some Mediterranean and south European flowering plants. Bot. Not. 109(3): 293-307.
CCDB · CromoCat 2015 — Loon van, J. C. (1980b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 718-720.
CCDB · CromoCat 2015 — Luque, T. & Díaz Lifante, Z. (1991). Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303-364.
CCDB · CromoCat 2015 — Pavone, P., C. M. Terrasi & A. Zizza. (1981b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXII]. Taxon 30(3): 695-696.
CCDB · CromoCat 2015 — Scrugli, A. & E. Bocchieri. (1976). Numeri cromosomatici per la Flora Italiana: 263-269. Inf. Bot. Ital. 8: 216-223.
CCDB · CromoCat 2015 — Snogerup, S. (1995b). Mediterranean chromosome number reports 5 (491--517). Fl. Medit. 5: 331-337.
+1 more references
2n 185×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Siljak-Yakovlev. 2005. Nuclear DNA content and chromosome number in some diploid and tetraploid Centaurea (Asteraceae: Cardueae) from the Dalmatia region. Pl. Biol. (Stuttgart) 7(4): 397–404.
CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S. & Nikolova, M. (1991). Kariologicno izsledvane na balgarski Sloznocvetni. IV. Tribus Carduae Cass. Fitologija 39: 3-22.
CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S. & Nikolova, V. (1986). Chromosome numbers of Bulgarian flowering plants. I, Fam. Asteraceae. Fitologija 31: 71-74.
2n 362×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Papes, D. & J. Radic. 1982. In IOPB chromosome number reports LXXVII. Taxon 31: 769–770.
CCDB · ipcn-api-dl — Radic, J. 1981. Centaureas endemic to the Biokova Mts. Acta Biokovica. 1: 71–145.
n 143×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 619-630. Ruz de Clavijo Jimnez, E.Anales Jard. Bot. Madrid47(2): 431-437(1990).
CCDB · ipcn-api-dl — Ruíz de Clavijo, E. 1990. Números cromosomáticos de plantas occidentales, 619--630. Anales Jard. Bot. Madrid 47: 431–437.
CCDB · CromoCat 2015 — Ruíz de Clavijo Jiménez, E. (1990a). Números cromosomáticos de plantas occidentales, 619-630. Anales Jard. Bot. Madrid 47(2): 431-437.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Vogt, R. & A. Aparicio. (1999). Chromosome numbers of plants collected during Iter Mediterraneum IV in Cyprus Bocconea, Monographiae Herbarii Mediterranei Panormitani 11: 117-169
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type4 122 records
Wild obs. + sensor3 179
Museum / vouchered908
Other35
Origin
Native160
Introduced7
Range
Area of Occupancy AOO9 848 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy56% within 1 km
≤100 m 514≤1 km 419≤10 km 719>10 km 20
1 672 georeferenced · 1 507 without coordinates
Open the mapobservation + sensor3 179
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy62% within 1 km
≤100 m 15≤1 km 146≤10 km 96>10 km 4
261 georeferenced · 647 without coordinates
Open the institutions mapphysical evidence908
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions26 of 51 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Berlin, DE | 268 |
| LDlocation not on record | 112 |
| BIO-UNIPIlocation not on record | 81 |
| València, ES | 50 |
| Jaén, ES | 35 |
| Granada, ES | 31 |
| CJBGlocation not on record | 31 |
| MAlocation not on record | 30 |
| Badajoz, ES | 24 |
| College of the Atlantic, Museumlocation not on record | 23 |
| Phyletisches Museum Jenalocation not on record | 18 |
| Wlocation not on record | 18 |
| BClocation not on record | 16 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 15 |
| Barcelona, ES | 12 |
| Alicante, ES | 12 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 11 |
| Paris, FR | 11 |
| BRNUlocation not on record | 10 |
| Córdoba, ES | 10 |
| Madrid, ES | 9 |
| Moscow State Universitylocation not on record | 9 |
| EEZA-CSIClocation not on record | 7 |
| Bratislava, SK | 5 |
| Entomological Society of Latvialocation not on record | 5 |
| Sevilla, ES | 5 |
| Salamanca, ES | 4 |
| Stockholm, SE | 4 |
| Frankfurt am Main | 3 |
| GJOlocation not on record | 3 |
| JBSlocation not on record | 3 |
| Adam Mickiewicz University in Poznańlocation not on record | 3 |
| Oskarshamn, SE | 2 |
| Görlitz, DE | 2 |
| Kew, GB | 2 |
| Provincia di Livornolocation not on record | 2 |
| University of Michigan, Herbariumlocation not on record | 1 |
| Salzburg, AT | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Bourges, FR | 1 |
| MeiseBGlocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Dresden, DE | 1 |
| Agriculture and Agri-Food Canada, Vascular Plant Herbariumlocation not on record | 1 |
| San Francisco, US | 1 |
| UIBlocation not on record | 1 |
| WTUlocation not on record | 1 |
| Northridge, US | 1 |
| Rishon Le Zion, IL | 1 |
| Bronx, US | 1 |
| Saint Louis, US | 1 |
51 institutions · 901 of 908 vouchered records shown · 6 without an institution code
09Environmental DNA6 detections
Where the DNA of Crupina crupinastrum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found6
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 6 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median9.80 °C 6.10–13.6
Seasonal swing summer↔winter19.6 °C
Max temp (day)13.9 °C 9.90–17.9
Min temp (night)5.30 °C 2.10–8.50
Precipitation64.9 mm/mo 59.0–70.7
Air humidity60.5 % 58.7–62.3
Moisture balance2.50 mm/mo -16.0–21.0
Vapour deficit556 Pa 375–737
Wind speed2.60 m/s
Cloud cover43.2 % 41.3–45.1
CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.