Crumenulopsis sororia

(P.Karst.) J.W.Groves · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Helotiales/Cenangiaceae/Crumenulopsis

At a glance

Occurrence records109

Data sources6

Biological traits0

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Crumenulopsis sororia's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility109 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.08 Gbp↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF109 records

DNA & barcodingNCBIsequences

Genome at a glanceGoaT80 Mbp

01Narrative

Crumenulopsis sororia is an ascomycete or cup fungus which can cause cankers on the bark of various species of Pinus, including Pinus contorta, Pinus nigra, Pinus sylvestris and Pinus cembra.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Crumenulopsis sororia has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOM808934.1 ↗505 bpLuxembourg · 2001

ACGT

GGATCATTAAAGTGTTGTGATCGTCAGCCCCCGGAATCCTCATAGGGATCGGGGCCGATCCCTCCCACCCGTGTGTATTTATACTTTGTT …

Crumenulopsis sororia voucher H.B. 6920c internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Crumenulopsis sororia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size79 800 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Crumenulopsis sororia0.08 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type109 records

Wild obs. + sensor21

Museum / vouchered88

Range

Area of Occupancy AOO168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 6≤1 km 5≤10 km 9

20 georeferenced · 1 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 3≤1 km 3≤10 km 63>10 km 1

70 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence88

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	75
San Sebastián, ES	3
Copenhagen, DK	1
Norwegian Institute of Bioeconomy Researchlocation not on record	1
Philadelphia, US	1
TROMlocation not on record	1
Olocation not on record	1

7 institutions · 83 of 88 vouchered records shown · 5 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)